1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kondor19780726 [428]
3 years ago
9

Which positive result could develop if carbon dioxide increases in the atmosphere?

Biology
1 answer:
VMariaS [17]3 years ago
6 0
The answer may be D. but there isnt enough info sorry...
You might be interested in
If a child belonged to blood type o, he or she could not have been produced by which set of parents?
jekas [21]
D. type a mother and type b father because they don’t have blood type o from their parent
7 0
3 years ago
What is the name for the smaller units that make up complex carbohydrates
saveliy_v [14]

Answer:

monosaccharide

Explanation:

Trust me I looked it up and found 6 out of 6 sites saying this.

7 0
3 years ago
Atrial pressure is greater than ventricular pressure during which phase of the cardiac cycle?
mars1129 [50]

Answer;

-Atrial contraction;

Explanation:

-The cardiac cycle comprises all of the physiological events associated with a single heartbeat, including electrical events, mechanical events (pressures and volumes), and heart sounds.The atria and ventricles alternately contract in each cardiac cycle.  The pressures in the chambers change greatly over the course of the cardiac cycle.

-During atrial contraction, blood flows from atria (high pressure) to ventricles (low pressure). Similarly, this same pressure gradient exists during ventricular filling.

3 0
3 years ago
What can a cold or flu pill do for a body?
dezoksy [38]
They might lessen the symptoms
5 0
4 years ago
What is the sequence ? ​
Bingel [31]
Answer:
A

EXPLANATION:
None
3 0
3 years ago
Other questions:
  • How can models be prevented from becoming theories
    13·2 answers
  • Difference between hypothesis and prediction examples
    14·1 answer
  • Choose a coccus and a bacillus from the organisms you observed and calculate their surface-to-volume ratios. Consider the coccus
    9·1 answer
  • Describe how the function of the contractile vacuole helps the protist stay alive
    14·1 answer
  • The viscosity of magma depends upon its silica content and its a. pahoehoe. b. temperature. c. magnetism. d. pyroclastic flow.
    11·2 answers
  • How do u loose weight fast​
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Does it matter if resection occurs in the 5′ to 3′ direction or the 3′ to 5′ direction?
    12·1 answer
  • ???????????????????????????
    12·2 answers
  • Which levels need to be correct for cells to function? Select four options.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!