1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shutvik [7]
3 years ago
6

A cheetah runs with a sudden burst of speed. Which process causes the production of the most of the energy the cheetah uses to r

un

Biology
2 answers:
nadya68 [22]3 years ago
8 0

The correct answer is B. Electron transport.

The electron transport chain is the terminal step of aerobic respiration. It occurs on the inner membrane of the mitochondria. Reduced coenzymes NADH and FADH₂ are produced during glycolysis and Krebs cycle. When NADH and FADH₂ move along electron transport chains, high-energy electrons are released from NADH and FADH₂ produce ATP.  The final electron acceptor in the process is free oxygen. Each NADH produces 3 ATP and each FADH₂ produces 2 ATP. Therefore, a total of 32 ATP molecules are generated in electron transport. Therefore, the electron transport system releases a lots of energy for cheetah to run fast.

erik [133]3 years ago
5 0

Answer:

Electron tansport

Explanation:

Answer confirmed , test taken.

You might be interested in
List the steps of dna replication in order
valina [46]
Initiation: Replication begins at a specific location called as OriC, at which some initiator protein bind and cause unwinding 
Elongation: New DNA stand grows, one base pair at a time. 
Termination: The two new double helices replace the older ones and the last primer strand is removed, followed by proofreading.
8 0
3 years ago
Read 2 more answers
For the water flea experiment the best answer is ______
WARRIOR [948]

c is the correct answer

8 0
3 years ago
What is the monomer that’s makes up polysaccharides
aniked [119]

Answer:

glucose

Explanation:

Polysaccharides are long chains of monosaccharides linked by glycosidic bonds. Three important polysaccharides, starch, glycogen, and cellulose, are composed of glucose. Starch and glycogen serve as short-term energy stores in plants and animals, respectively. The glucose monomers are linked by α glycosidic bonds.

4 0
3 years ago
At which stage would centromeres of sister chromatids Disjoin and chromatids separate?
Debora [2.8K]

Answer:

Anaphase II.

Explanation:

Cell division may be defied as the phenomena by which the cell multiply and increases its number under the influence of cell cycle checkpoints. Two main type of cell division are meiosis and mitosis.

The meiosis result in the formation of four haploid cells from the single parent diploid cell. The Anaphase II of meiosis leads to the disjoin of the sister chromatids and the separation of chromatids. This is similar to the anaphase of mitosis.

Thus, the correct answer is anaphase II.

4 0
3 years ago
12. Leaf cells in trees store lots of water and glucose from photosynthesis. What organelle should the
choli [55]

Answer:

cytoplasm

Explanation: knowledge

8 0
3 years ago
Read 2 more answers
Other questions:
  • The optic nerve is located in which cavity?
    15·1 answer
  • Deanna explains to Wesley the different types of nitrogen in the nitrogen cycle. Choose the sentences that she includes in her e
    6·1 answer
  • What are the main risk and main benefit of a society using geothermal energy?
    6·2 answers
  • Summarize microevolution and macroevolution and describe the diiferce between the two
    13·1 answer
  • What type of mutation occurred for mutated sequence #1 and what was the result?
    5·1 answer
  • Which of the following is an extinct group of mollusks related to today's chambered nautilus?
    14·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which two characteristics describes the most stable ecosystem on Earth?
    7·2 answers
  • Help me pls! In your own words, explain how the information carried by mRNA is used in the ribosome to form proteins. Be sure to
    10·1 answer
  • Reducing, reusing, and recycling are used to Group of answer choices make more ores increase metal production burn fossil fuels
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!