1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stepladder [879]
3 years ago
10

At which stage would centromeres of sister chromatids Disjoin and chromatids separate?

Biology
1 answer:
Debora [2.8K]3 years ago
4 0

Answer:

Anaphase II.

Explanation:

Cell division may be defied as the phenomena by which the cell multiply and increases its number under the influence of cell cycle checkpoints. Two main type of cell division are meiosis and mitosis.

The meiosis result in the formation of four haploid cells from the single parent diploid cell. The Anaphase II of meiosis leads to the disjoin of the sister chromatids and the separation of chromatids. This is similar to the anaphase of mitosis.

Thus, the correct answer is anaphase II.

You might be interested in
In glycolysis, the first stage of cellular respiration, ATP molecules are produced.
Hatshy [7]
<em>in the process of glycolysis ,, the products are 
<u>1 net gain of 2 ATPs..
</u>
<u>2 2 pyruvic acid
</u><u>3 2NADH2...:)</u>
</em>
3 0
3 years ago
Read 2 more answers
Imagine that new evidence is found that changes how the Doppler effect is viewed. It shows that objects in the red spectrum are
Y_Kistochka [10]
It would show that is universe in not expanding but contracting
6 0
3 years ago
Read 2 more answers
All cellular organisms can be placed into one of three __________, which include the Bacteria, Archaea, and the Eukarya.
olchik [2.2K]

Answer:

Domains

Explanation:

All Biological organism can be classified or placed in a group.

Taxonomy is a branch of science that deals with naming and classification of biological organism based on shared characteristics.

In taxonomy, a domain is the highest order of classification or ranking ,its even higher than the kingdoms.

It is inclusive of all biological grouping.

All cellular organisms can be placed in any of the three domains namely, Bacteria, Archaea and the Eukarya.

7 0
3 years ago
What two types of geologic processes formed the major features of the California landscape
MrRissso [65]

Answer:

Geological processes are those process that occurs on the surface and subsurface regions of the earth crust. They facilitate in shaping the Earth, and helps in concentration of resources over a region. These processes occurred millions of years ago, the chances are their that they will occur in future as well. Some of the major features of the California landscape develop as a result of plate tectonics and other features develop due to the process of erosion under the influence of wind, water, ice and other features.

3 0
3 years ago
The main function of the central nervous system is to what?
aksik [14]

Answer: Its responsible for integrating sensory information and responding accordingly

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • Why do organisms go through the process of meiosis?
    8·1 answer
  • Which of the following statements accurately describes enzymes? A. Many different types of substrates with different shapes can
    10·1 answer
  • Which is not an example of an earth system cycle?
    9·2 answers
  • The arteries that branch from the aorta and provide blood to the heart muscle itself are _______________ arteries. a. pulmonary
    8·1 answer
  • Which of the following is NOT a component of a nucleotide?
    13·1 answer
  • A young patient (aged 22 years old) has been prescribed Xanax for their generalized anxiety disorder. They turn to you and ask w
    8·1 answer
  • Why do people need to wear sunscreen at the beach?
    12·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • List three potential problems that could arise from drilling for oil in the tundra.
    10·1 answer
  • Sugars are used for energy and what else??
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!