1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
loris [4]
4 years ago
15

Compare the Venn diagram of sexual reproduction and asexual reproduction in plants. Where in the diagram would you add identical

to parent?
A) A
B) B
C) C
D) D
Biology
2 answers:
lina2011 [118]4 years ago
4 0
<h3>♫ - - - - - - - - - - - - - - - ~Hello There!~ - - - - - - - - - - - - - - - ♫</h3>

➷ Well, I can't really see the Venn diagram as you haven't attached it. However, it is asexual reproduction that produces offspring identical to the parent. Sexual reproduction leads to variation in the offspring. In other words, the offspring wouldn't be identical to the parent.

Therefore, you need to place it into just asexual reproduction.

<h3><u>✽</u></h3>

➶ Hope This Helps You!

➶ Good Luck (:

➶ Have A Great Day ^-^

↬ ʜᴀɴɴᴀʜ ♡

Maurinko [17]4 years ago
3 0

Answer:

C

Explanation:

The answer is C on USATEST

You might be interested in
You should be familiar with the drugstore antibiotic ointment Neosporin (Triple antibiotic ointment), which is often thought of
FromTheMoon [43]

Answer: Antibiotics are chemicals which, in low concentrations, can selectively kill or inhibit the growth of most pathogenic bacteria and are not harmful to humans.

Explanation:

Neosporin is a type of antibiotics which is used for the treatment or prevention of mild superficial infections. It consists of three active component, hence the name Triple antibiotic ointment. These active components, their mode of action and side effects include:

--> NEOMYCIN : This is one of the active components of Neosporin which inhibits the protein synthesis of an invading pathogenic bacteria through irreversible binding to the 30 S ribosomal subunit of susceptible bacteria. Their MODE OF ACTION is bactericidal meaning that the effect it has on the protein synthesis inhibits it's growth leading to the death of the bacteria.

SIDE EFFECTS: it can cause irritation, burning, itching, rash redness when applied topically.

--> POLYMYXIN: This is one of the active components of neosporin which attacks the invading pathogenic gram negative bacteria. In its mode of action, is the ability to combine with and disorganise structures of the bacterial cell which are responsible for the maintenance of the osmotic equilibrium of the cell thereby exposing the underlying peptidoglycan layer to lysozyme.

SIDE EFFECTS: Burning, redness, or irritation of the skin may occur.

--> BACITRACIN: This is also one of the active components of Neosporin. In its mode of action, it inhibits bacterial cell wall synthesis. This is achieved by preventing the final dephosphorylation step in the phospholipid carrier cycle, which interferes with the mucopeptide transfer to the growing cell wall.

SIDE EFFECTS: it may cause rash, itching/swelling (especially of the face/tongue/throat).

These three active components of Neosporin are combined to broaden the antibacterial spectrum. This means that at least one of the active components will effectively kill an invading pathogenic bacteria through its unique mode of action.

5 0
3 years ago
Margot is pregnant with her first child, and she is deliriously happy! She and her husband have some tests taken, but before the
Alecsey [184]

Answer:

"Its a girl!"

Explanation:

XX chromosomes result in a female baby. While, an XY pair results in a boy.

5 0
3 years ago
Read 2 more answers
mass can be measured with a triple beam balance in units of ______. a. grams b. newtons c. cubic centimeters d. millimeters
Anestetic [448]
The answer is
(a)-grams
6 0
3 years ago
A chick becomes a chicken over a period of several<br> weeks.
Serggg [28]

Answer:

This is <em>true </em>!!

Explanation:

In general terms, chickens are said to be adults when they reach sexual maturity and begin the process of laying eggs. This will typically happen when the birds are between 16 and 24 weeks of age, depending on the breed. However, the time might also vary from individual to individual, as some will develop more quickly or slowly than others. If you need a ballpark figure, a young chicken can usually be considered mature when it reaches 18 weeks of life.

7 0
3 years ago
How are plants involved in the Carbon Cycle? What happens to the carbon?
Svet_ta [14]

Plants absorb carbon dioxide,water and sunlight to make their own food,grow and release oxygen through photosynthesis. They're a huge part in keeping our air clean. The carbon becomes part of the plant. ... When humans burn fossil fuels, most carbon enters the atmosphere as carbon dioxide.

Carbon moves from fossil fuels to the atmosphere when fuels are burned. When humans burn fossil fuels to power factories, power plants, cars and trucks, most of the carbon quickly enters the atmosphere as carbon dioxide gas. ... Carbon moves from the atmosphere to the oceans.

7 0
3 years ago
Other questions:
  • Why is the Great Garbage Patch known as “Trash Vortex”.
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Minerals may form on Earth’s surface when
    14·2 answers
  • I really need this done right now!!!!!
    13·2 answers
  • A Punnett square is drawn for parents, one of whom has phenylketonuria, a recessive genetic disorder, and the other who is a car
    7·2 answers
  • Which microbial virulence factor is most important for attachment to host respiratory tissues?
    5·1 answer
  • Scenario 1: The bell rings at the end of class and you jump up to head for the door. When you stand up, you feel light-headed. W
    11·1 answer
  • Synthesis is defined as separating the pieces of a cell
    7·1 answer
  • refer to vs map: gene expression—flow of information from gene to protein tour. in which ribosome site would you find the unchar
    10·1 answer
  • What are the two major modes of glycolysis and what is the purpose of each mode?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!