Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
There are a lot of separation processes. To name a few, these can be distillation, centrifugation, extraction, membrane or sorption process and many other. To know which is the best technique, you should know the property between two substances that have a stark difference. In this case, it is the polarity. Ethyl alcohol is more polar than ethyl ester and less dense. Thus, these two won't mix. So, take advantage of their density difference by decantation or centrifugation.
First, we calculate the mass of the sample:
mass = density x volume
mass = 8.48 x 112.5
mass = 954 grams
Now, we will calculate the mass of each component using its percentage mass, then divide it by its atomic mass to find the moles and finally multiply the number of moles by the number of particles in a mole, that is, 6.02 x 10²³.
Zinc mass = 0.37 x 954
Zinc mass = 352.98 g
Zinc moles = 352.98 / 65
Zinc moles = 5.43
Zinc atoms = 5.43 x 6.02 x 10²³
Zinc atoms = 3.27 x 10²⁴
Copper mass = 0.63 x 954
Copper mass = 601.02 g
Copper moles = 601.02 / 64
Copper moles = 9.39
Copper atoms = 9.39 x 6.02 x 10²³
Copper atoms = 5.56 x 10²⁴
