Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
Proteins play a fundamental role for life and are the most versatile and diverse biomolecules. They are essential for the growth of the organism and perform a huge amount of different functions.
The passage of DNA to proteins begins with the step of transforming genetic information into an intermediary between DNA and protein. This intermediary is called messenger RNA (mRNA). The difference between DNA and mRNA is that the second corresponds to a very small fraction of all DNA, consists of a single chain (it is no longer a “zipper” but a strand), and that Thymine (T) is replaced by the Uracil (U). This fraction corresponds to the stretch of DNA that contains the sequence necessary to ultimately synthesize the protein.
Answer:
The transfer of mature pollen grain from anther of the flower to the stigma of the same flower of the same [species is called self pollination.
Generally, the transfer of pollen grains by wind,animals,and water to stigmas is called pollination. It is a means of vegetative propagation which ensures reproduction.
Therefore during self pollination, the same genes are distributed from one generation to another. Thus genetic purity is ensured. It also ensured reproductive success. because there is little chance of the pollen grain getting lost in transit. It is also certain a particular plant would always breed true.
Additionally it prevent the process of transfer of genes in some transgenic crops( rice, maize) where through genetic engineering some genes are introduced in their genome.
The only negative effect is lack of genetic diversity. Therefore after a period of time the plants get weak and prone to diseases and infection. Because of poor resistant from lack of variation.
Explanation:
