1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
d1i1m1o1n [39]
3 years ago
13

Which is not part of the description for communication? A. sending a signal B. learning to signal C. responding to a signal D. r

eceiving a signal
Biology
2 answers:
Zanzabum3 years ago
8 0

B. learning to signal

Serga [27]3 years ago
5 0

The answer is B.

Hope this helps.

You might be interested in
SOMEONE PLZ HELP WITH THIS FAST
lara31 [8.8K]

Answer:

The first one is the second one, and the second one is the third one.

Explanation:

4 0
3 years ago
Read 2 more answers
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
will a point mutation or a frameshift mutation have a larger impact on the protein coded for by the DNA?
guapka [62]

Answer:

frameshift mutation (i think)

Explanation:

because it messes up the whole strand by deleting or inserting a base. honestly not 100% sure so take this with a grain of salt lol

5 0
3 years ago
Identify one hormone present in a female that is involved in regulating the reproductive cycle? ​
ioda

Answer: The hormones controlling the female reproductive system include gonadotropin-releasing hormone (GnRH), follicle-stimulating hormone (FSH) and leutenizing hormone (LH), all of which are produced in the brain; oestrogen and progesterone produced by the ovaries and the corpus luteum; and human chorionic gonadotropin (HCG

7 0
3 years ago
Describe two ways polar bears are well adapted to surviving during the Arctic winter.
cricket20 [7]
They are well at surviving because of their thick white coat. The white fur helps them blend in with the snow and ice. The polar bear also has a layer of fat under their skin so they can survive harsh temperatures. 
4 0
3 years ago
Other questions:
  • The picture above shows an extinct, Australian thylacine. Based on the picture, which inference made by an observer would be ina
    5·1 answer
  • White short-horned cattle and Black Angus cattle have been crossed to produce offspring with superior beef and rapid growth qual
    8·1 answer
  • Infantile characteristics, such as _________, tend to be very appealing to humans and other species that invest heavily in the r
    7·1 answer
  • If a child has a disorder called trisomy 16 what is wrong with there cells​
    7·1 answer
  • Pairs of the same chromosome as found in a karyotype are called homologous chromosomes. True False
    11·1 answer
  • A labradoodle is a cross between?
    7·2 answers
  • which following food chain grass grasshopper field mouse red tailed hawk which organism in the food chain is the producer
    12·1 answer
  • TED Talk speakers are generally
    8·1 answer
  • Is it true that paper is warm and metal is cold? Can metal sometimes be warm? Can paper be
    10·1 answer
  • Help please
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!