1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
a_sh-v [17]
3 years ago
8

Which of the following could possibly increase genetic variation indirectly?

Biology
2 answers:
Svetradugi [14.3K]3 years ago
6 0
4. new habitat or <span>2. predator-prey relationships but i think it is more likely 4

</span>
denis-greek [22]3 years ago
3 0
Its the forth one i guess 
You might be interested in
34. Enzymes produced by human cells generally work best at temperatures close to​
Tanya [424]

Answer:

37 degrees Celsius

Explanation:

Most enzymes in the human body function best at around 37 degrees Celsius, which is 98.6 degrees Fahrenheit.

3 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
What is the difference between heat<br> and temperature
pickupchik [31]

Answer:

Situation

Explanation:

Heat is transferred

Temperature is how "hot" or "cold" an object is

3 0
3 years ago
Hummingbirds need large amounts of energy to flap their wings between 60 and 200 times per second. Their wings beat so rapidly t
Rzqust [24]
I think the answer would be G
5 0
3 years ago
Sources of the heat inside earth?
allochka39001 [22]
Sources of heat from inside earth is radioactive decay and residual heat.
7 0
3 years ago
Other questions:
  • Describe two examples of abiotic and biotic factors that a cow can experience in its environment.
    15·1 answer
  • Genetic engineering has already been used to increase plant production. True False
    7·1 answer
  • Which energy source does not originate from the sun?
    8·1 answer
  • Foreign cells that enter our body have unique cell surface proteins, known as ________, which stimulate our body's defense to at
    12·2 answers
  • If a characteristic is X-linked it
    7·1 answer
  • Global climate change
    8·2 answers
  • A niche is part of an organism's habitat.<br><br> True or False?
    8·2 answers
  • Mr. and Mrs. Green have a daughter, Georgia, who was born at Riverside Community Hospital. Mr. and Mrs. Blue have a daughter, Be
    9·1 answer
  • Question 13 (1 point) How much does hair grow on average in one month?
    7·1 answer
  • Describe a scenario where a stimulus creates an external response.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!