<h2>Answer:</h2>
The correct answer is option C. And the full statement is:
The end product of transcription is <u>__mRNA___</u> and the end product of translation is _<u>_Proteins_</u>__.
<h3>Explanation:</h3>
- Translation and the transcription are the two main process of central dogma of life.
- DNA is the nucleotide sequence for the protein production. In this process DNA is first converted to RNA and then RNA moves to the cytoplasm for the production of proteins in the ribosomes.
- So the transcription is process in which DNA is converted into mRNA in the cytoplasm.
- In cytoplasm production of proteins by the mRNA is known as translation.
Answer:
Translocation
Explanation:
Translocation is a chromosomal defect in which part of a chromosome breaks off and reattaches backward on the same chromosome.
Translocation can happen due to many reasons like:
A) Some of the changes that arise around the time of conception or production of sperm or egg.
B) The inheritance of altered chromosome from father or mother.
Translocations can be divided into two forms:
- Reciprocal translocation
- Robertsonian translocation.
In reciprocal translocations, fragments of two chromosomes break off from two different places, break and swap each other's segments. While in Robertsonian translocation one chromosome attached with other.
Hope it help!
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
