Absorbed lipids are transported from intestinal epithelial cells to the lymphatic system in what form

1 answer:

6 0

When a lipid is absorbed, it gets transported to the lymphatic system in the form of chylomicrons. Chylomicrons are lipoproteins that absorb lipids from the intestine, and take them to the lymphatic system.

Answer:

$\boxed{\bf~Chylomicrons.}$

Hope it helped,

Happy homework/ study/ exam!

You might be interested in

Why would fog dispersion be useful?

Andru [333]

Answer:

Fog dispersal, artificial dissipation of fogs, usually by seeding or heating. ... It is done primarily at airports to improve visibility.

4 0

3 years ago

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0

3 years ago

N labrador retrievers, black coat (b) is dominant to brown coat (b) and normal vision (n) is dominant to blindness (n). the gene

Grace [21]

<span>Ans : BbNn x bbnn - gives:

In a ratio of 1;1:1:1
BbNn - 1/4 black normal
Bbnn - 1/4 black blind
bbNn - 1/4 brown normal
bbnn - 1/4 brown blind</span>

7 0

3 years ago

Read 2 more answers

What does undergo mean

Tasya [4]

Answer:

Undergo means to experience or take part in something.

Explanation:

If you undergo something, you are undertaking it.

Also see; undergo, undergoes, undergoing, undergone, underwent.

"During metamorphosis, an animal will undergo change."

3 0