Answer:
The answer is 6.8 meters.
Explanation:
During the S phase of the cell replication, the DNA is doubled before the division of the cell which means that it is twice it's original length.
At 0.34 nanometers, 3 billion base pairs (3.000.000.000) comes up to 3.4 meters and during the S phase the length is doubled so it is 6.8 meters long.
I hope this answer helps.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
look the explanation
Explanation:
The development of antibiotics has revolutionized the treatment of infectious diseases. However, antibiotic overuse is a major contributor to the development of antibiotic-resistant bacteria. Antibiotic resistance is a genetic trait.
Secondary since plants/animals already lived there, but got killed/driven out of the area they lived/thrived in/on.
