1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fantom [35]
3 years ago
5

Rates of erosion are only used for features formed ________ to __________ years ago.

Biology
2 answers:
aliya0001 [1]3 years ago
6 0
<span>it is Method for determining Absolute Age</span>
Anton [14]3 years ago
6 0

,erosion is the action of surface processes (such as water flow or wind) 

You might be interested in
How do mutations work in dna sequences? I'm so lost​
liraira [26]

Answer:

A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is copied or as the result of environmental factors such as UV light and cigarette smoke. Mutations can occur during DNA replication if errors are made and not corrected in time.

6 0
2 years ago
A student measured a books cover and recorded the length as 28.1 cm and the width as 22.7 cm.
wariber [46]

Answer: P= (Lx2)+(Wx2)

A=Bxh

Explanation:depends if you are finding area or perimeter. Area is base multiply by height (or length times width).

Perimeter is base times 2 plus width times 2 (or add all the sides up)

8 0
3 years ago
4. What are ecological races? How do they form?
Hoochie [10]
In biological<span> taxonomy, </span>race<span> is an informal rank in the taxonomic hierarchy, below the level of subspecies. ... </span>Races <span>may be genetically distinct phenotypic populations of interbreeding individuals within the same species.
i really hope this helps (:</span>
6 0
3 years ago
Which description is not an example of an adaptation?
jarptica [38.1K]

Answer:

an individual choosing to put on a coat to stay warm

Explanation:

A choice is not an adaptation because adaptations are more biological.

5 0
3 years ago
When a body is buried directly in the soil, both toxic chemical products of decomposition and nutrient-rich decomposition fluids
ValentinkaMS [17]

Cadaver Decomposition Island

-  When a body is buried directly in the soil, then it is subject to decomposition by insects and microorganisms. 

<span>- </span>During this process, a self-digestion of the cells occurs as well as anaerobic decomposition of animal proteins resulting in a release of various chemical components.

<span>- </span>This nutrient-rich fluid is trapped in the soil matrix for a long period of time resulting in the formation of Cadaver Decomposition Island

<span>- The formation of Cadaver Decomposition Island is associated with increased microbial biomass and activity.</span>

7 0
3 years ago
Other questions:
  • Which of the following types of reactions would decrease the entropy within a cell?
    15·1 answer
  • Fats are made of an alcohol called ?
    10·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • When a physical weakness or psychological distress renders a victim incapable of resisting or deterring crime, this is referred
    6·1 answer
  • When individuals of the same species are reproductively isolated, genetic differences may accumulate in sufficient number so tha
    13·1 answer
  • Which cell organelle stores and sends nutrients throughout the cell?
    8·1 answer
  • DNA does all but which of the following?
    11·1 answer
  • What effects can an invasive species have on an ecosystem?Choose all that apply
    14·2 answers
  • 100 points and brainliest!!
    8·1 answer
  • What are two way metamorphic rocks can be changed to sedimentary rock
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!