1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marrrta [24]
2 years ago
15

What are the 3 main characteristics of populations?

Biology
2 answers:
MaRussiya [10]2 years ago
7 0

Answer:

Population Size and Density: Total size is generally expressed as the number of individuals in a population. ...

Population dispersion or spatial distribution: ...

Age structure: ...

Natality (birth rate): ...

Mortality (death rate):

Explanation:

olasank [31]2 years ago
3 0

Answer:

Size, Spatial Distribution and age structure or, birth and death rates.

Explanation:

Demography is the study of a population, the total number of people or organisms in a given area. Understanding how population characteristics such as size, spatial distribution, age structure, or birth rates change over time can help scientists and/or governments.

You might be interested in
What is the difference between food chains and food webs?
Harlamova29_29 [7]
<span>food chains follow just one path of energy as animals find food.

</span>food webs show how plants and animals are involved in ways to help them all survive. 
4 0
3 years ago
Read 2 more answers
Does warm air rise or sink? Does cold air rise or sink? Need a summary 30 points
andriy [413]
Warm sinks cold rises

8 0
3 years ago
Proteins that are functionally less important for the survival of an organism generally evolve _____ more important proteins.
Reika [66]

Proteins that are functionally less important for the survival of an organism generally evolve faster than more important proteins.

Proteins serve as the building blocks for all of life's essential processes. The proteins evolve along with the genes that create them, adding new functionality or features that may potentially result in the development of new species.

The mutation of amino acid-coding nucleotides and the stabilization of novel variations in the population are the two phases required for protein evolution.

The stability of a protein's folded structure, how well it prevents aggregation, and how well it is chaperoned all affect how quickly it evolves. According to the studies, the degree of a protein's expression has a greater influence on its evolutionary rate than does the protein's functional significance.

To learn more about protein and mutation here,

brainly.com/question/16238140

#SPJ4

7 0
1 year ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
What part of the intestinal tract prevents backflow of food from the stomach into the esophagus? a. diaphragm b. lower esophagea
lara31 [8.8K]

Answer:

The correct option is b. lower esophageal sphincter

Explanation:

The esophagus is the initial part of the digestive tract and its function is the transport of the alimentary bolus from the pharynx to the stomach, through the thorax and avoid the reflux thereof. It begins and ends in two sphincter structures, the upper esophageal sphincter and the lower esophageal sphincter, which separate it from the pharynx and stomach. The lower esophageal sphincter has two functions: relax during swallowing and prevent reflux of the gastric contents into the esophagus in the postdeglutory period. After swallowing, there is a relaxation of the lower esophageal sphincter, pressure dropping to levels similar to those of the gastric fundus, which allows the bolus to enter the stomach. This relaxation lasts a few seconds and is followed by a strong contraction that prevents backflow of food.

4 0
3 years ago
Read 2 more answers
Other questions:
  • A testable hypothesis could be formed from which question
    15·2 answers
  • Which is an example of homeostasis?
    5·1 answer
  • What type of sign warns you to watch right and left for cross traffic?
    11·1 answer
  • Lactase is a protein in the digestive tract that helps break down certain sugars found in milk. What is the main function of lac
    15·2 answers
  • Which group of organisms is most closely related to Archeabacteria?
    14·2 answers
  • Which of the traits were likely present in the last common ancestor of bryophytes? Please choose the correct answer from the fol
    9·1 answer
  • According to the phenotypic characters of pneumococcus considered in Griffith's
    10·1 answer
  • Which type of molecules make up the majority of a cell’s plasma membrane
    9·1 answer
  • Replanting trees on a bare hillside is an EXAMPLE of
    9·2 answers
  • If carbon dioxide is completely removed from a plant’s environment, what would you expect to happen to the plant’s production of
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!