1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
baherus [9]
3 years ago
9

How many carbon atoms are in one molecule of pryuvic acid

Biology
1 answer:
antoniya [11.8K]3 years ago
3 0
There are 3 carbon atoms
You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
What is the primary product of light-independent reactions?
Alina [70]

The correct answers are;

A.) High energy sugars

A) ATP

The light-independent (dark) reactions are chemical reactions of photosynthesis which occurs within the stoma in plant chloroplast. These reactions use the products of light-dependent reactions which are ATP and NADPH with some enzymes (such as RuBisCO) to carry out its processes. Carbon dioxide and other compounds are converted to produce high energy sugars (glucose) which is used by the plant.

Glycolysis is the cellular degradation of the simple sugar (glucose) to produce pyruvic acid (also known as pyruvate), and ATP (adenosine triphosphate) is used as an energy source.


8 0
3 years ago
Read 2 more answers
How are proteins regulated after translation? active proteins can be inactivated by post‑translational modification existing mRN
Sonja [21]

Answer:

inactive proteins can be activated by phosphorylation

Explanation:

Proteins are regulated after translation by the non-covalent binding of small molecules. These molecules include amino acids or nucleotides. A change in the conformation and thus, the activity of the protein is usually achieved when this occurs.

Proteins could also be regulated by phosphorylation which is the addition of phosphate groups of specific amino acids on the protein.

3 0
3 years ago
Berkowitz and LePage (1967) found that frustrated men delivered more shocks when:_____
Y_Kistochka [10]

Answer: d. guns happened to be in the room.

Explanation:

The weapon effect theory is a theory of social psychology. It suggests that mere presence of weapon or its picture can lead to aggressive behavior or may produce shock in human participants.

This theory was demonstrated by the Leonard Berkowitz and Anthony LePage in 1967. These researchers selected 100 male university students for one laboratory session.

These were randomly assigned to receive one or seven shocks. These shocks generated by the weapon those were kept on the laboratory and were related to belong to one of the peer. This will may generate mental shock among the students.

3 0
4 years ago
LUIZ
oksano4ka [1.4K]

Answer:

anwser is C

Explanation:

they both have 6 carbon atoms so A is wrong

both are monosacchride so B is wrong

both have same molecular formula which is (C₆H₁₂O₆) so D is wrong

in glucose the anomeric carbon is the first carbon, whereas in fructose, the anomeric carbon is the second carbon. The anomeric carbon is the one containing the carbonyl group (carbonyl group is a functional group composed of a carbon atom double-bonded to an oxygen atom: C=O)

4 0
3 years ago
Other questions:
  • Which statement correctly describes the process that occurs in the thylakoid? ATP is produced in the thylakoid during light-inde
    15·2 answers
  • Which of the following is NOT a necessary input for the process of photosynthesis? A. CO2 (carbon dioxide) B. Sunlight C. H2O (w
    11·2 answers
  • Ribs that are not attached to the sternum at their anterior costal cartilages are known as1.vertebrochondral ribs2.vertebrostern
    5·1 answer
  • Select all that apply. Which of the following are related to smog? lowered visibility lung diseases deforestation ocean acidific
    7·2 answers
  • What impact does reforestation have on the environment?
    12·2 answers
  • Match each root with its meaning.
    7·1 answer
  • Why are girls so complicated
    7·1 answer
  • Lab ntroduction # 32 Wolves and Rabbits Predator-Prey Simulation
    15·1 answer
  • If you’re looking at tissue samples, how can you determine if there is cancer? What are some visual differences?
    15·2 answers
  • I WILL GIVE BRAINLIEST!!!
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!