1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shalnov [3]
4 years ago
5

Polio is a disease that can cause paralysis. Doctors treated patients with casts and braces, but the work of Elizabeth Kenny led

to the use of hot baths and exercise to treat polio victims. These patients had less incidence of paralysis. Kenny’s ideas and their acceptance were due to
Biology
1 answer:
Radda [10]4 years ago
8 0
<span>Kenny's ideas and their acceptance were due to open mindedness. Elizabeth Kenny was born on 20th of September in the year 1880 and died on 30th of November in the year 1952. She was an unaccredited Australian nurse who treated polio in a different manner.</span>
You might be interested in
The sodium-potassium pump moves _____ sodium ions and _____ potassium ions simultaneously.
Andrews [41]

Answer: The sodium-potassium pump system moves sodium and potassium ions against large concentration gradients. It moves two potassium ions into the cell where potassium levels are high, and pumps three sodium ions out of the cell and into the extracellular fluid.

Explanation:

4 0
3 years ago
Why does the enzyme trypsin get deactivated when introduced in the gastric juice of the stomach?
svetoff [14.1K]
In my Biology Honors Class, they taught about gastric juice, or also known as    (p H) which is formed by stomach glands, is very acidic and can seriously mess up enzyme trypsin functions. After all, enzymes are a type of catalyst that help break down food, which means that enzymes are a sort of digestive acid as well. Hope this helps!
3 0
4 years ago
______ is exemplified by a new starfish developing out of a single ray, or arm.
umka2103 [35]
I'm pretty sure the blank is underneath. Hope this helped. Have a great day! :D
5 0
4 years ago
Suppose an explorer discovered a unique new species of plant and collected a sample for analysis by a geneticist. The geneticist
adoni [48]

my brain can't process this lol

6 0
3 years ago
What is the molar mass of a substance?
Ipatiy [6.2K]

Answer:

The correct answer is: the mass in grams of one mole of a substance

Explanation:

The molar mass of a given substance corresponds to the mass of one mole of this in grams. Corresponds to a physical property of the substance. Example: the molar mass of water (H20) is:

Molar mass H20 = (Mass H) x 2 + Mass 0 = 2 x 1 g + 16 g = 18 g / mol

7 0
3 years ago
Read 2 more answers
Other questions:
  • Robert told his friend to go on the atkins diet and he begins experiencing ketosis. what would his symptoms be
    5·1 answer
  • Earthquakes with a richter magnitude of less than ______ are generally not felt by humans.
    10·1 answer
  • What nutrient is a necessary component of the diet of pregnant women in order to prevent neural tube defects?\?
    9·1 answer
  • Someone help please urgent
    10·1 answer
  • Many functions in the body are controlled by
    15·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • PLEASE HELP!!! 50 POINTS!
    7·2 answers
  • SOMEONE HELP ME WITH THIS QUESTION
    15·1 answer
  • The movement of oxygen across the cell membrane is an example of what type of transport
    7·1 answer
  • What are at least TWO differences between PASSIVE transport and ACTIVE transport?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!