1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brilliant_brown [7]
3 years ago
15

A 500-page book contains 250 sheets of paper. The thickness of the paper used to manufacture the book has mean 0.08 mm and stand

ard deviation0.01mm. What is the probability that a randomly chosen book is more than 20.2 mm thick (not including the covers)
Mathematics
1 answer:
Oksi-84 [34.3K]3 years ago
5 0

Answer:

Probability = 0.1038 or 10.38%

Step-by-step explanation:

Given,

Number of sheets n = 250

Mean \mu =0.08

Standard deviation \sigma =0.01

S_{n} = Sum of sample items.

From the Central Limit Theorem we get, S_{n}~N(n\mu ,n\sigma^2)

n\mu = 250 × 0.08

        = 20

\sigma^2S_{n}=n\sigma^2

        = 250(0.01)²

        = 0.025

Therefore, S_{n}~N(20,0.025)

The Z-value corresponding to 20.2 :

Z=\frac{20.2-20}{\sqrt{0.025}}

= 1.26

Finally, P(S_{n}>20.2)=P(z>1.26)

                                  = 1 - 0.8962

                                  = 0.1038

Probability = 0.1038 or 10.38%

You might be interested in
What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
Papessa [141]

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

8 0
3 years ago
Read 2 more answers
Which of the following equations represents a horizontal line? (A y=x) (B x=5) (C y=-12) (D y=-x+1)
boyakko [2]
The answer is (C y=-12) Due to the fact that the line would be on the y axis, below 12, straight across. 
3 0
3 years ago
What is the length of the hypotenuse of the triangle?
Roman55 [17]

Answer:

StartRoot 58 EndRoot cm

THE ANSWER IS D

Step-by-step explanation:

6 0
3 years ago
I forgot about this one
Andrej [43]

Answer:

D

Step-by-step explanation:

As you look at the domain, which is going side to side,you can see there is not a definate end to the line which means that it is all real numbers which then whittles down your answer to either C or D.

when you look at the range, the up and down of it, you can see that  it stops at -8 which is also the lowest point on the graph in the y-axis. since -8 is the smallest point for the range, then the Y would be greater than or equal to for the first part, which means it would be either A or D.

as you look at both answers to the questions, they only have D in common which means D is the answer.

5 0
3 years ago
A baseball club pays a vendor $135 per game for selling bags of peanuts for $4.25 each. (a) Write a linear function that describ
qaws [65]

A linear function is a numerical relationship that forms a straight line in the Cartesian plane and represents the number of units that change a dependent variable, increase or decrease, compared to an independent one, in this case the profit P of the baseball club will be given by the number b of peanut bags sold multiplied by the sales value ($4,25), this less the payment of the seller's work day ($135), that is:

P = $4.25 b-$135

Answer

The linear function that describes the profit of the baseball club is

P = 4.25 b-135

5 0
4 years ago
Other questions:
  • Tom throws a ball into the air. The ball travels on a parabolic path represented by the equation h = -8t 2 + 40t, where h repres
    5·2 answers
  • Which statements are correct? Check all that apply. A chord is sometimes a radius. A diameter is always a chord. A tangent is ne
    7·2 answers
  • How do you simplify 56ab/b?​
    9·1 answer
  • find an equation for the nth term of the arithmetic sequence. -15, -6, 3, 12, ... select one: a. an = -15 9(n 1) b. an = -15 x 9
    7·1 answer
  • A model rocket is launched with an initial upward velocity of 195 ft/s. The rocket's height h (in feet) after t seconds is given
    7·1 answer
  • Winston's soup recipe makes 6 servings and uses 4 carrots and 2 potatoes. Drag carrots and potatoes into the box to show how man
    5·2 answers
  • 0.424 round each number to the place of the underlined digit. The underline number is 2.
    6·2 answers
  • Help please I need it​
    9·2 answers
  • Emily is blocking off several rooms in a hotel for guests coming to her wedding. The hotel can reserve small rooms that can hold
    11·1 answer
  • Question 12 (1 point)
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!