1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ber [7]
4 years ago
12

Horace was born 26 weeks after conception. he now is a healthy, happy 2-year-old. horace's ability to survive after being born s

o early was due in part to his reaching the _____. term of postnatal development germinal period neurogenesis point age of viability
Biology
1 answer:
Alex Ar [27]4 years ago
4 0
Although Horace was born 26 weeks after conception, he was able to survive and become a happy and healthy 2-year old boy because he was able to reach the age of viability. The age of viability is reached during week 21-22 of the pregnancy. In this stage, the lungs gain some ability to breathe air. Thus, survival outside the womb may be possible for some babies. 
You might be interested in
Help me please and thank you​
ANEK [815]

Answer:

The moons gravity pulls on the water :)

7 0
3 years ago
He made a baby quilt that was 3 feet wide its perimeter was 16 ft what was its area
VikaD [51]
Answer:
15
Explanation: we know the width is 3 so we have two widths that are 3 and make up 6, 16-6=10
10/2=5 for both lengths. We only need one length and one width 3x5=15
5 0
3 years ago
Describe the interior of the rats stomach
melamori03 [73]
Same as any stomach, a small, mucus-coated tissue balloon, filled with acid.









ew.
3 0
3 years ago
What is the common property of competitive and non competitive enzyme inhibitors
olasank [31]

Competitive inhibition can be overcome by increasing the concentration of substrate while uncompetitive and noncompetitive inhibition cannot. Enzyme inhibitors are molecules or compounds that bind to enzymes and result in a decrease in their activity.

8 0
3 years ago
Each section of DNA that is used to make proteins is called a​
stealth61 [152]

Answer:

genes

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Why are ammonite fossils found in the Himalayas?
    10·2 answers
  • What types of equipment would you need to take measurements In a lab
    9·1 answer
  • The concentration and toxicity of a chemical in the body is affected by: a. route of entry into the body b. received dose of the
    13·1 answer
  • Which of the following best explains what would happen if there were no decomposers in an ecosystem?
    6·1 answer
  • A human's breathing rate can be affected by
    11·2 answers
  • How is the membrane surface area increased within cells and organelles
    7·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • What is the platform of ADNOC called?<br> (Please dont comment files)
    6·1 answer
  • I think ik the answer but i'm not sure it that's the answer.
    8·2 answers
  • There are over 8.5 million different species identified on Earth.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!