1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iren2701 [21]
4 years ago
12

True or false perception is the process of receiving stimulus energies

Biology
1 answer:
tamaranim1 [39]4 years ago
6 0
Through my research I found questions similar to this and it appears you forgot to add ''from the external environment and transforming those energies into neural energy'' after stimulus energies, and if that's correct than the answer would be FALSE because that's not true.
You might be interested in
How can we decide the direction of the magnetic field?
ehidna [41]

Answer:

The right hand rule states that: to determine the direction of the magnetic force on a positive moving charge, ƒ, point the thumb of the right hand in the direction of v, the fingers in the direction of B, and a perpendicular to the palm points in the direction of F.

Explanation:

5 0
3 years ago
How do bones and muscles help in the mexmert. glahuman body? ? Explain with an example​
marusya05 [52]

The muscles of the muscular system keep bones in place; they assist with movement by contracting and pulling on the bones. To allow motion, different bones are connected by joints which are connected to other bones and muscle fibers via connective tissues such as tendons and ligaments.

8 0
3 years ago
What process does a multicellular organism use to replace its damaged body cells? A. Transcription B. Translation C. Mitosis D.
Alisiya [41]
C. Mitosis, 
Zygote developed into a multicellular organism......Mitosis
Identical daughter cells produced...Meiosis
Damaged cells in wounds....Mitosis
Reduction in Chromosomes number of daughter cells....Meiosis
7 0
3 years ago
Read 2 more answers
WALLAHI HELP ME PLEASE THIS SO HARD WALLAHI PLS
Rus_ich [418]

Answer:

B

Explanation:

Kasi po yung Mantle mainit sya may magma ganon. And also the statement of B was a false statement po kase po yung Mantle it never gets cool kaya ganon mainit lagi do yeah B yung sagot

6 0
3 years ago
Infectious agents ( bacteria, virus and Protozoa) are NOT the cause of water pollution?
USPshnik [31]
If it’s a yes or no question then yes because they spread through organisms. there are many organisms in the water that bacteria can spread through
6 0
3 years ago
Other questions:
  • Please HELP NOT SURE
    12·2 answers
  • A student poured a solution of bromothymol blue indicator into three test tubes. Then he placed an aquatic plant in two of the t
    5·1 answer
  • What is the effect of differential reproduction over time?
    5·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which of the following is an example of the endocrine system directly interacting with the nervous system?
    14·1 answer
  • A pedigree is not helpful to a counselor in predicting the probability of a recessive gene being present and the chances for an
    11·1 answer
  • In 1668, Francesco Redi conducted an experiment with jars of meat. This experiment was noteworthy because it
    15·1 answer
  • Protists are often grouped according to whether they are plant-like, fungus-like, or________.
    8·2 answers
  • Give an example of a specific joint in the human skeletal system.<br> Please help
    15·2 answers
  • why is it not advisable for farmers to use large amounts of artificial fertilizer especially in close proximity to a pond or lak
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!