1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aniked [119]
3 years ago
14

from a chemical perspective the words molecule and compound can be used interchangeably. True or False

Biology
1 answer:
Ratling [72]3 years ago
5 0

Answer:

False

Explanation:

A molecule can be defined as a particle that comprises of two or more atoms of an element that are bound together by a chemical bond. Molecules are usually electrically neutral. An example of a molecule is O2 (oxygen molecule); it comprises of two atoms of oxygen

A compound can be defined as a substance that is made of two or more different chemical elements that are bound together by a chemical bond which could either be an ionic bond or a covalent bond. An example of a compound is NaCl which is table salt; NaCl is a compound that is made up of one sodium element (Na) and one chlorine element (Cl) bound together by ionic bonds.

Therefore, when atoms combine, they form molecules, while a compound is a molecule that comprises of atoms of different elements. So we can say that not all molecules are compounds, but all compounds are molecules, hence molecule and compound can't be used interchangeably.

You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
What is the definition for Allele?
Bumek [7]

Explanation:

One of a number of alternative forms of the same gene occupying a given position, or locus, on a chromosome is allele.

5 0
3 years ago
Read 2 more answers
Fish developed many characteristics for survival. Match the parts of the fish to their correct functions.
umka21 [38]
Gills allow the fishes to breathe underwater. Scales help the fish in external environments due to waters. And find help balance the fish becoming more quicker. Mouth let’s fish eat small algae. And eyes help fish see electric move money from muscles to help see.
5 0
3 years ago
Which of these is the BEST way to illustrate the percentage of students receiving A's, B's, C's, D's and F's on a recent test?
makvit [3.9K]

Answer: ummmmmmm

Explanation: ur mom?

6 0
3 years ago
The Metro Police are investigating a murder scene the killer was scratched by his victim and some of his skin cells are found un
blagie [28]
I'm not that sure, but I think it's D.
8 0
3 years ago
Read 2 more answers
Other questions:
  • What do parasitism, predation, and commensalism have in common? How are they different? (Site 1)
    5·2 answers
  • When making a guess and retesting this information, a theory or ___________ may be formed which explains why something has occur
    10·1 answer
  • The Virginia Opossum has gradually spread from the east coast of the United States to the West Coast as well as the northward in
    12·2 answers
  • A natural satellite _____.
    12·1 answer
  • Choose all the answers that apply.
    10·1 answer
  • Color or label each circle with the color that results when two paints mix.
    15·1 answer
  • Which of the following is a way that nitrogen atoms move from a nonliving part of the environment into a living part of the envi
    6·2 answers
  • Needing help with this.
    8·1 answer
  • How does volcanic rock in Hawaii turn into sediment?
    5·2 answers
  • s achieved when there is an equal concentration of water and electrolytes inside and outside the body's cells. 2. Charged ions s
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!