1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
labwork [276]
3 years ago
5

The Monterey pine and the Bishop's pine inhabit some of the same areas of central California. The Monterey pine releases pollen

in February, while the Bishop's pine does so in April. This is an example of ________ isolation.
Biology
1 answer:
Naddik [55]3 years ago
3 0

Answer:

The Monterey pine and the Bishop's pine inhabit some of the same areas of central California. The Monterey pine releases pollen in February, while the Bishop's pine does so in April. This is an example of <u>temporal</u> isolation.

Explanation:

Temporal isolation is a form of reproductive isolation in which two or more species reproduce at two separate times.

<u>For example:</u> Northern america leapord frog mates in April and North America Bullfrog mates in july.

As in the given scenario, reproductive isolation is occuring in which two species (Monterey pine and Bishop's pine) are reproducing (producing pollens) at two separate times(February and April). Hence it is an example of temporal isolation.

You might be interested in
An inherited characteristic that increases an organism’s ability to survive and reproduce in its specific environment is called
OverLord2011 [107]
The answer your looking for is adaptation. I would know, for I just recently finished a chapter on it.
8 0
3 years ago
Sublimation is the opposite of deposition just as evaporation is the opposite of fusion transpiration freezing condensation
Lena [83]
<span>A condensation is a process where liquid changes into a gaseous form also known as water vapour. It occurs in the atmosphere when the temperature rises.
Water is produce when glucose and fructose undergo a condensation process. The water is removed by the combination of hydrogen and a hydroxyl together. Glucose and Fructose forms a substance called glycosidic linkage. And hydrogen and hydroxyl is separated from glucose and fructose. When Hydrogen and hydroxyl is combined, they create H2o or water.</span><span>
</span>
5 0
2 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Researchers cross a corn plant that is pure-breeding for the dominant traits colored aleurone (C1), full kernel (Sh), and waxy e
olasank [31]

D) #recombinant=116+601+4+2+113+625=1462

   #nonrecombinant=2538+2708=5246

  RF=R/(N+R)=1462/6708=0.2

  E) I=1-Q

I-interference

Q-coefficient of coincidence

Q=O2Xo/E2xo(2xo-double crossovers)

O2xo=6

P=(distance from C1 to Sh/100)*(distance from Sh to Wx/100)

=(3.38/100)*(18.28/100)=0.006

E2xo=0.006*6708=40.248

Q=6/40.248=0.15

I=1-0.15=0.85

7 0
3 years ago
Enchanted Rock State Natural Area is located in Central Texas. Enchanted Rock is a dome of granite. The area contains four easil
pav-90 [236]

Answer:

D) Granite rock

Explanation:

Enchanted Rock is a dome of granite, so you would pick this answer choice.

I am joyous to assist you anytime.

8 0
3 years ago
Other questions:
  • How have amphibians adapted to living in desert environments​
    7·1 answer
  • Why are there more overweight humans than animals?
    7·1 answer
  • How do composite volcanoes get its layered interior?
    10·2 answers
  • What type of species is most likely to lead to extinction of another species? a Invasive species b Native species c Genetically
    5·1 answer
  • 1.3. Why is it important to prioritise your life goals?​
    15·2 answers
  • Which of the following statements best represents the theory of pangenesis developed by Hippocrates?
    10·1 answer
  • Please help me
    9·1 answer
  • Which is the end result of cytokinesis from a cell undergoing mitosis?
    9·2 answers
  • 2. Мынадай: «метр», «сантиметр», «миллиметр», «микрометр», «мик-
    11·1 answer
  • Which of these is dictated by the law of supply and demand?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!