Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
Gary would perform the duty of <u>handwriting analysis</u> in civil justice more often than what he does as a criminal forensic scientist.
Gary is a police officer who is also a forensic scientist, working in the criminal justice system. This means he collects, analyzes fingerprints, examining blood spatter all to have evidence against a criminal. Know, he works in the criminal justice system meaning the government, which could be government law enforcers would need those evidence against an accused individual at a federal or state criminal court. On the other hand, in a civil justice system, citizens can bring lawsuits against one another.
Now he would like to work for the civil justice system, and for his experience as a criminal forensic scientist, he would fit handwriting analysis since handwriting analysis is also a forensic practice done for the purpose of providing evidence in court. But this time he would be assessing the identity of a person from their written documents where there are differences between writing samples instead of processing fingerprints.
In summary, Gary would perform the duty of handwriting analysis in civil justice systems assessing the identity of a person from their written documents.
Learn more about handwriting analysis here: brainly.com/question/3084230
Answer:
Forces affect how objects move. They may cause motion; they may also slow, stop, or change the direction of motion of an object that is already moving. Since force cause changes in the speed or direction of an object, we can say that forces cause changes in velocity. Remember that acceleration is a change in velocity.
Explanation:
The answer to this question is:
<span>Which of the following is characteristic of the second stage within a demographic transition?
</span><span> D-"The death rate begins to fall, but birth rates remain high for a time."
Hoped This Helped, </span><span>
Tiffbmt90
Your Welcome :) </span>
Answer:
energy pyramid. How many units of energy are available in each of
the three levels of consumption? Show your calculations. Tip: First, change the
percents to decimals.
Explanation: