1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marianna [84]
4 years ago
14

What did charles darwin learn from the fossils of a giant armadillo that he found in argentina?

Biology
1 answer:
Korolek [52]4 years ago
5 0
Modern animals may be related to fossilized organisms.
You might be interested in
A few years ago Robert noticed a few gray hairs. A little frustrated, he was able to isolate and pluck them out one by one; howe
kotykmax [81]

Answer:

c. mid-adulthood

Explanation:

This stage of life when gray hairs  become overwhelming in number and he has more gray hairs than brunette( brown hair) is called middle adulthood. Middle adulthood spans from 20 to 40 years of life which may be defined differently for different culture and country.

Robert is in his late mid adulthood somewhere near 40 at this age hair generally grow grey.

4 0
3 years ago
Write about how the group of rock layers in record a forme include tilting erosion and folding
neonofarm [45]

Answer:

Most sedimentary rocks are formed in level layers. Therefore, the occurrence of tilted rock layers is evidence of mountain building. ... Tilting can also result when rocks are pushed upward, or uplifted. In some areas of the world, rock layers are so severely tilted that they may be bottom side up. Layered rocks form when particles settle from water or air. Steno's Law of Original Horizontality states that most sediments, when originally formed, were laid down horizontally. ... Rock layers are also called strata (the plural form of the Latin word stratum), and stratigraphy is the science of strata.

6 0
3 years ago
2. Skeletal muscle:
lubasha [3.4K]
The answer is D, all of the above.
7 0
3 years ago
The nervous system works through secretion of
8090 [49]
Acetylcholine..

hope it helps
6 0
3 years ago
Koalas are marsupials that are found in eastern Australia. Although their ancestors lived mostly on the ground,
Andrew [12]

Answer:

Fur color that closely matches the eucalyptus bark color

Explanation:

In terms of evolving from land dwellers to tree dwellers, the number of offspring does not matter. Although the ability to run faster is a good evolution for escaping predators, it does not help the koalas evolve to be better tree dwellers (how would you run using only the trees?). Communicating with their peers would be convenient for survival, but it does not help koalas become better tree dwellers. What does help koalas survive better by traveling through the trees is camouflaging with the bark of the tree to hide from predators.

3 0
3 years ago
Other questions:
  • To neutralize all the negative charge from an object, simply touch it with _________.
    5·1 answer
  • What happens when a sodium ion is attracted to a clorine ion
    15·2 answers
  • A scientist thinks that a certain chemical is a mutagen. She exposes plant cells to a large amount of this chemical in the labor
    7·1 answer
  • What energy systems does your body use to support the 100s trial in the experiment? refer back to information presented in activ
    13·1 answer
  • PLEASE HELP I WILL MARK BRAINALISTTTT
    15·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Place the steps of constructing a genomic library in order. I. Digest phage with restriction enzyme. II. Lyse cells of interest
    5·1 answer
  • HELP ASAPPP Why can insertions and deletions affect more than just the codon(s) that they directly change? Hint: Why are they ca
    13·1 answer
  • The energy used when force affects something<br> O Speed<br> O Work<br> O Motion<br> O Force
    7·1 answer
  • Which of the following models shows the flow of energy in a woodland ecosystem? Select the two correct answers A.sun → tree → ca
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!