It has been associated
with<span> later crawling but not with later walking. The reality is that
any baby who is a healthy child should be put to sleep on his/her back rather
than on their stomach or sides by their mothers or whosoever takes care of
them. This practice is really useful to lessen the dangers of sudden infant
death syndrome.</span>
Yeah, they are right!! Child with group A must be adopted
As john's genotype would be Ib Ib, which must pass his one Ib, and in the presence of that, offspring can't be of type A
Answer:
black hair: 25%, chestnut hair, 75%
Explanation:
Heterzygous is when an organism has two different alleles (one dominate, one recessive). If your form a Punnet square (Ee on top, Ee on sides) the allele combinations are:
1: EE
2: Ee
3: Ee
4: ee
Therefore e, the black hair, has 25% because the other times it is masked by the dominate allele. Chestnut hair has 75%, represented by E.
Answer:
a) ATGCATACGGCATACCCGTAA
B) AUGCAUACGGCAUACCCGUAA
Explanation:
For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine
For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.
