1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tanzania [10]
4 years ago
15

How does the reproductive isolation effect gene pools of the two populations?

Biology
1 answer:
Darya [45]4 years ago
4 0

B) they stay the same for many generations

You might be interested in
The initiative to have infants sleep on their back, rather than their stomach, has been associated with:
Svetllana [295]

It has been associated with<span> later crawling but not with later walking. The reality is that any baby who is a healthy child should be put to sleep on his/her back rather than on their stomach or sides by their mothers or whosoever takes care of them. This practice is really useful to lessen the dangers of sudden infant death syndrome.</span>

7 0
3 years ago
Mary has type A blood and her husband (John) has type B blood. John's parents both had type AB. Mary and John havethree children
Pepsi [2]

Yeah, they are right!! Child with group A must be adopted

As john's genotype would be Ib Ib, which must pass his one Ib, and in the presence of that, offspring can't be of type A

4 0
3 years ago
Horses, having chestnut hair (E) is dominant over having black hair (e). Two heterozygous horses are crossed.
expeople1 [14]

Answer:

black hair: 25%, chestnut hair, 75%

Explanation:

Heterzygous is when an organism has two different alleles (one dominate, one recessive). If your form a Punnet square (Ee on top, Ee on sides) the allele combinations are:

1: EE

2: Ee

3: Ee

4: ee

Therefore e, the black hair, has 25% because the other times it is masked by the dominate allele. Chestnut hair has 75%, represented by E.

5 0
3 years ago
Given the following DNA strand TACGTATGCCGTATGGGCATT
Ber [7]

Answer:

a) ATGCATACGGCATACCCGTAA

B) AUGCAUACGGCAUACCCGUAA

Explanation:

For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine

For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.

7 0
3 years ago
grand haven, michigan and lansing mi are located at similar latitud. aGrand Haven gets more snow, why?
dybincka [34]

Answer:

 

Explanation:

4 0
3 years ago
Other questions:
  • Explain the difference between a guess and a prediction [if possible keep it short xD]
    8·2 answers
  • Why isn’t the remaining grape sugar converted to ethanol and carbon dioxide
    14·1 answer
  • 27) A 10 kg box is sitting on a shelf 15 feet in the air. How could you increase the potential energy of the box? (check all tha
    14·1 answer
  • The fact that there is considerable variation among individuals in height, eye color, and other characteristics demonstrates men
    12·1 answer
  • The transduction of sound waves into action potentials occurs ________.
    7·1 answer
  • Select the correct answer.
    7·2 answers
  • 6) This organelle has a rough and smooth version that performs two different functions. The rough version relays proteins and th
    7·1 answer
  • A researcher had 15 purebred wikl mice which were brown and all females, they were all mated with a male called Bob, All offspri
    10·1 answer
  • Organisms that have a membrane nucleus belong in which domain?
    7·1 answer
  • How is it possible for mad made things to move?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!