1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alina1380 [7]
3 years ago
8

Given the following DNA strand TACGTATGCCGTATGGGCATT

Biology
1 answer:
Ber [7]3 years ago
7 0

Answer:

a) ATGCATACGGCATACCCGTAA

B) AUGCAUACGGCAUACCCGUAA

Explanation:

For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine

For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.

You might be interested in
Which of the following are examples of tissue? (Select all that apply.)
Maurinko [17]

Answer:

Blood and Nerves

Explanation:

Blood is a connective tissue that has a fluid matrix, called plasma, and no fibers. Erythrocytes (red blood cells), the predominant cell type, are involved in the transport of oxygen and carbon dioxide. Also present are various leukocytes (white blood cells) involved in immune response.

Nervous tissue is one of four major classes of tissues. It is specialized tissue found in the central nervous system and the peripheral nervous system. It consists of neurons and supporting cells called neuroglia. The nervous system is responsible for the control of the body and the communication among its parts.

6 0
4 years ago
Human genetic material is represented in the diagram<br> below.
Mrrafil [7]

Answer:

diagram is weird and unrealistic but B is the only reasonable answer.

Explanation:

B only makes sense - everything else is unreasonable. Proteins don't become enzymes since enzymes are already proteins, there are no proteins, carbohydrates, or glucose molecules in the image.

3 0
3 years ago
Beneficial micro-organisms that are responsible for breaking down organic matter are called?.
Lina20 [59]
Decomposers break down organic matter.
Some examples are fungi,bacteria and protozoa.
7 0
2 years ago
Part C
melisa1 [442]

Answer:

because it can change in an instant

Explanation:

4 0
3 years ago
Read 2 more answers
Why is meosis important
evablogger [386]

Answer:

Meiosis is important because it ensures that all organisms produced via sexual reproduction contain the correct number of chromosomes.

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • A 54 year old male is diagnosed with septicemia. what most likely caused this diagnosis?
    5·1 answer
  • When a landslide occurs it is most likely due to:
    7·2 answers
  • A fire in the Everglades damages a large area. A forest fire in Alaska of the same size experiences similar damages. Which ecosy
    6·2 answers
  • Does any one know number <br> 7.<br> 8.<br> 9.
    12·1 answer
  • 2. This cell structure acts as the "brain" or command center for the cell.
    11·1 answer
  • After surgery for removal of cataract, a client is being discharged, and the nurse has completed discharge instruction. Which cl
    12·1 answer
  • What is the role of each of the following in the carbon cycle? Include an example of each. a) Producer b) Primary consumer c) De
    7·1 answer
  • Parkinson's disease prevents the brain from properly sending motor signals to the consciously moved muscles of the body. This di
    13·2 answers
  • When their food is scarce, robins in a community must either starve to death or.
    6·2 answers
  • Paramecium are single cell eukaryotes that live in fresh (pure) water. They have a vacuole that contracts to expel excess water
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!