1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mama L [17]
3 years ago
11

Which of the following does the human body not do to maintain homeostasis

Biology
2 answers:
galina1969 [7]3 years ago
7 0
C.reproduce
Homeostasis is the maintenance of a constant internal environment. It ensures that the composition of body fluids is kept within narrow limits. The body sweats to lose heat through evaporation of water on the surface of the skin so that one does not die of overheating. You can also lose heat through your waste in the form of faeces and urine.The body will shiver (spasmodic contraction of the skeletal muscles) to increase the amount of heat releases in your blood and helps to raise your body temperature to normal. Reproduction is not an example of what your body does in homeostasis. Hope this helps!
DerKrebs [107]3 years ago
6 0
The answer would be C) reproduce or the third option.
You might be interested in
What does it mean to say that one species facilitates another species?
Slav-nsk [51]
Its when one species marries another species
7 0
3 years ago
What is competition what organism be competing for
lora16 [44]
Organism in an eniornment can compte for food
4 0
3 years ago
Which kind of rock is most likely to contain a trilobite fossil?
egoroff_w [7]

Answer:

Sandstone

Sandstone contains fossils of creatures such as trilobites, brachiopods, crustaceans, bryozoans and plants. Remains of land animals like mastodons and dinosaurs are much more likely to be found in sandstone.

Explanation:

thank me later

7 0
2 years ago
Read 2 more answers
What are three ways in which water influences climate
irakobra [83]
Oceans act as conveyor belts of cold and warm water, <span>sending heat toward the polar regions and helping tropical areas cool off.

helps distribute heat around the globe

stores solar radiation</span>
6 0
3 years ago
................................................................
kolezko [41]

Answer:

This is an experiment question sheet, which means you have to actually do the experiment to get the answers.

Explanation:

I was in biology and had to do one of these.

7 0
3 years ago
Other questions:
  • what is the mutation caused by the addition of a nucleotide to an already existing gene sequence called
    15·1 answer
  • Which of the following is NOT true of neutrophils?
    7·1 answer
  • Which eukaryotic organelles is primarily responsible for cellular digestion
    12·1 answer
  • Which of the following is NOT true regarding carbon dioxide (CO2)
    11·1 answer
  • The end daughter cells are diploid or haploid
    9·1 answer
  • When two objects are near each other, how would increasing one object’s mass affect it?
    11·2 answers
  • Please help with my biology
    9·1 answer
  • When does dna synthesis occur in meiosis
    10·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • How does ocean currents affect the air temperature of Christchurch,
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!