1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ale4655 [162]
4 years ago
12

The Two Main Processes By Which Plant Cells Absorb Release And Use Energy

Biology
2 answers:
noname [10]4 years ago
8 0

photosynthesis and respiration

UNO [17]4 years ago
8 0

Answer:

respiration

Explanation:

You might be interested in
3c. explain what a codon is. include the words "nucleotides" and "amino acid" in your answer.
Harrizon [31]
Each combination of 3 nucleotides are called a codon. The codons then determine which amino acids are going to be inserted in the protein
5 0
3 years ago
How does the Sun heat the Earth?<br><br>Explain your answer in your own words.
iris [78.8K]

Explanation:

The sun heats the earth through radiation. Since there is no medium (like the gas in our atmosphere) in space, radiation is the primary way that heat travels in space. When the heat reaches the earth it warms the molecules of the atmosphere, and they warm other molecules and so on.

8 0
3 years ago
Henry was studying two populations of the same species of lizards. One population lived on an island and the other lived on the
Llana [10]

the island is a small specie of lizards so if the mainland specie was a large population it would have been the one to be affected by an increase instead of a decrease. The genetic drift was caused by not having enough of the same kind to keep the heredity going, most likely the largest population is the one that had enough of the same heredity to keep the population of lizards going. In a way the hurricane with the force on both species caused a genetic drift but increased a larger population for a year later.

8 0
3 years ago
In the video, Craig Venter says, "We are trying to understand basic life, by learning how to now write the genetic code. So we s
Triss [41]

Answer:

A,C,G,T

Explanation:

The DNA is a macromolecule formed by two strands of polynucleotides forming a double helix.

These chains are composed of monomers called nucleotides, there are 4 different types in DNA, called nitrogenous bases: two purines, guanine (G) and adenine (A) and two pyrimidines, thymine (T) and cytosine (C). They are joined by covalent bonds in each chain in a complementary way. G with C and A with T.

These are the chemicals Craig Venter has in the four bottles.

6 0
4 years ago
A female rabbit reaches reproductive maturity at about six months of age. Both young and adult rabbits are highly subject to pre
natka813 [3]

Answer:

fast, intensive reproductive investment

Explanation:

8 0
4 years ago
Other questions:
  • Endoplasmic Reticulum -what is the function
    14·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Pancreatic cancer, or _____ is the fourth leading cause of cancer death in the united states
    11·1 answer
  • Silicate minerals polymerize to form a variety of structures. three-dimensional structures have ________ silicon than those comp
    5·2 answers
  • During the light reactions of photosynthesis, plants convert light energy into
    15·1 answer
  • All cells in multicellular organisms contain thousands of different kinds of enzymes that are specialized to catalyze different
    11·2 answers
  • How struggle for existence drove evolution of organism please
    11·1 answer
  • Which one is the true answer
    12·1 answer
  • Which property of water is the result of hydrogen bonds?
    5·1 answer
  • Tell me please help me
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!