1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Degger [83]
3 years ago
9

Water is a _____ molecule.

Biology
2 answers:
sdas [7]3 years ago
8 0
It is a polar molecule
STatiana [176]3 years ago
6 0
Water is a POLAR molecule.

You might be interested in
When measuring a patient's tympanic temperature, the nurse would angle the thermometer probe in what direction?
never [62]
In practice it is enough to simply angle the thermometer towards the direction of the ear canal. More specifically you are trying to target the direction of the tympanic membrane located in the middle ear (one of the parts of the ear; the other parts being outer and inner)

Some maneuvers, although not completely necessary, may include pulling the ear lobe upwards and outwards for babies. This is to straighten the ear canal and is more often done when using otoscopes. For adults, we pull the ear downward and outward.
5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What specific type of experiment demonstrated that cadherins were sufficient to mediate cell-cell adhesion?
aivan3 [116]

Answer:

Answer is A. Expression of Cadherin gene in the cell that do not normally adhere to each other( or have low adhesion function).

Explanation:

Not that, the level of Cadherin expression influences the streght of adhesion and the type of Cadherin expressed, in determining the specificity and property of interaction.

5 0
3 years ago
When recombinant DNA is inserted into the genome of a host organism, what's created?
Lostsunrise [7]
A. A transgenic organism
Transgenic means "crossed genes" whichnis what happened
6 0
4 years ago
What are the roles of hydrogen peroxide, oxygen, hydrogen, and catalase in the following chemical reaction
olga_2 [115]
Catalase is an enzyme, O2 and H2O are substrates, and H2O2 is a reactant.
Catalase is a substrate, O2 and H2O are substrates, and H2O2 is an enzyme.
Catalase is a substrate, O2 and H2O are products, and H2O2 is an enzyme.
<span>Catalase is an enzyme, O2 and H2O are products, and H2O2 is a substrate.</span>
7 0
3 years ago
Other questions:
  • If a cell has 18 chromosomes, how many chromosomes would each daughter cell have after mitosis?
    13·1 answer
  • Which process produces clones?
    11·2 answers
  • Classification is a way of grouping organisms based on the _______they share.
    13·2 answers
  • Help please...................
    8·2 answers
  • Soil erosion can be reduced by
    9·1 answer
  • What was the total maginification (25 points)
    9·1 answer
  • Plz help this is past due
    6·2 answers
  • Plz answer question.
    8·2 answers
  • How does sweating during exercise help maintain homeostasis?
    8·1 answer
  • A student examining leaf cross sections under a microscope finds many loosely packed cells with relatively thin cell walls. The
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!