1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ValentinkaMS [17]
3 years ago
12

Bacteria naturally prefer company instead of solitude for growth. Examples of this kind of communal growth pattern can be found

everywhere, from surfaces of the teeth and the intestines, to the surface of a slimy rock in the lake, to the thick floc that clogs water pipes. These examples of communal bacterial growth are known by what name?
A) infectious unit
B) colony
C) biofilm
D) planktonic unit
Biology
1 answer:
myrzilka [38]3 years ago
5 0

Answer:

The correct option is (C). The above mentioned definition is true for biofilm that resembles a slimy structure composed of cells attached to each other.

Explanation:

 The adherent cells that results due to the formation of biofilm are known to invade the slimy extracellular matrix that are made up of extracellular polymeric substances. These embedded cells serves the function of production of EPS component that is composed of genetic material, polysaccharides and lipids. These biofilms are capable of growth on the living as well as the non living things.  

Formation of biofilm by the microbes occurs due to several factors namely nutritional factors, antibiotic attack and cellular recognition to the attachment site. The defined steps of the biofilm formation includes initial attachment, Irreversible attachment, Maturation I, Maturation II and Dispersion.

You might be interested in
 Which of the following is nothuman-caused groundwater pollution? ​
frozen [14]

Answer:

D

Explanation:

D is the only option where the cause of the pollution is not something man-made.

4 0
3 years ago
Read 2 more answers
Which best summarizes the effects of mutations on organisms?
iren [92.7K]

Answer:

A Mutations are sometimes helpful, sometimes harmful, and sometimes neutral.

Explanation:

I did the test.

6 0
3 years ago
Read 2 more answers
What to do to reduce weight and become thin in 1 month
Gennadij [26K]

Answer:

Eat fig and do exercise every day

4 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
This is the last part of the cell cycle. This is process in which the cytoplasm is divided between the two new daughter cells.
never [62]
This process is called Cytokineses.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Stars that are medium-sized are
    15·1 answer
  • What are 3 things you can determine about different types of paper
    10·1 answer
  • Some people have nearsightedness (myopia) and farsightedness (hyperopia) because the distance between their _____ and their ____
    12·2 answers
  • A hornless bull is crossed with three cows, A, B, and C. Cow A is horned and produces calf A’, which is also horned. Cow B is ho
    8·1 answer
  • What is a gene?
    14·1 answer
  • A scientist discovers that a soil bacterium he has been studying produces an antimicrobial that kills gram-negative bacteria. Sh
    15·1 answer
  • What fundamental functions do cells carry out?
    5·1 answer
  • "Character is what you are in the dark."
    5·1 answer
  • Which statement identifies an example of a genetic factor that could influence the growth or development of an organism created
    11·1 answer
  • Genetic drift tends to occur in populations that are what?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!