1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GalinKa [24]
3 years ago
14

The process of nuclear division which creates two new identical nuclei is called

Biology
2 answers:
Alina [70]3 years ago
8 0

Answer:

Mitose

Explanation:

Mitosis is a type of cell division that occurs in all eukaryotic cells and ensures the formation of two daughter cells with identified nuclei. It is an important process for the growth and regeneration of multicellular organisms and for asexual reproduction of unicellular organisms.

Despite being a continuous process, mitosis can be divided into four distinct phases: prophase, metaphase, anaphase and telophase. This process begins after the interphase period, which comprises the time between two phases of cell division.

zzz [600]3 years ago
6 0
<span>the answer is mitosis, where the nucleus divides into <span>two identical nuclei</span></span>
You might be interested in
Cells _________ in order to create cells that perform specific functions.
nika2105 [10]

Cells differentiate in order to create cells that perform specific functions.

8 0
3 years ago
Read 2 more answers
What process do plants use to eliminate carbon dioxide
Rina8888 [55]
By eliminating co2 do you mean respiration?
5 0
4 years ago
Plant cells have a ____ white animal cell do not.
masha68 [24]

Plant cells have cell wall but animal cells don't have any cell wall.

6 0
3 years ago
Which statement best describes how the temperature of the oceans surface water varies
PSYCHO15rus [73]
Areas with the warmest is the surface
8 0
4 years ago
Read 2 more answers
How does the Muscular System work at the organ level?<br> 3 complete sentences in your own words.
puteri [66]
If I answer it then its not in your own words…...
6 0
4 years ago
Read 2 more answers
Other questions:
  • If a parent cell has four chromodomes,how many chromosomes will each daughter cell have.
    10·1 answer
  • list two major ways the earth's atmosphere was different 3 billion years agi before the advent of photosynthesis
    7·1 answer
  • Match each molecule with the group of carbohydrates it belongs to
    8·1 answer
  • HOW DOES A GRASSLAND FOLLOW CONSERVATION OF MASS AND ENERGY
    11·1 answer
  • Honeybees have a remarkable way of transferring information about the location of a food source to other members of the hive. Th
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • How many parents does a strawberry plant have?
    8·1 answer
  • why is it important to assume a sample size of 100 grams when solving empirical and molecular formula problems?
    12·1 answer
  • How would you expect the return of the wolves to yellowstone to affect the other species there?
    14·1 answer
  • I-The cyclist goes from Isa town to Muharraq in 5 hours. The distance covered by a cyclist is 20 km. What is the speed of cyclis
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!