1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga_2 [115]
3 years ago
11

Natural selection acts only on individual organisms and cannot affect the survivability of an entire species.

Biology
2 answers:
ikadub [295]3 years ago
7 0
False, if too many individual organisms die, the speices might die out
Elis [28]3 years ago
7 0

Answer:

     The right answer to this question is option B. False.

Explanation:

      The main reason why this is not true is that natural selection is totally dependent on food chain and environment as a whole. This means that, there's a need of a whole population for a single organism to pass their adapted genes to another one. For example, if there's an environment with a certain kind of food for squirrels, and something happens to this environment that the food there is another type, if only one squirrel is born with the gene to eat this food, natural selection will kill not only this one at the end of its life, but the rest of the population that couldn't adapt to it.

You might be interested in
I just want to eat chicken legs should I its kinda far?
masha68 [24]

Answer:

yes

Explanation:

do what you love!!!!!!!!!!!!!

5 0
3 years ago
Read 2 more answers
Which effect of temperature rise causes a feedback resulting in a rise in global temperatures?
r-ruslan [8.4K]

Answer:

c

Explanation:

cause the less the vapor the more the direct heat

8 0
3 years ago
The Colorado river flows through the Grand Canyon. Which characteristic of the river is directly affected by the amount of preci
Irina18 [472]

Answer:

Volume, and February

Explanation:

just took the test:)))

4 0
3 years ago
Read 2 more answers
Which describes a population that has reached the largest number of individuals that the environment can support over a long per
strojnjashka [21]
It is a. Has no limiting factors
6 0
3 years ago
Why might humans purposefully cause disturbances in an ecosystem? Explain
irina1246 [14]

Alot of humans might not now they are even harming the systems by smoking or littering.

8 0
3 years ago
Other questions:
  • When a horizontally positioned plant responds to gravity,
    14·2 answers
  • The _____ is the layer of tissue that forms during gastrulation and becomes the animal's organs. a. ectoderm b. mesoderm c. endo
    5·1 answer
  • Can somebody please help?
    5·1 answer
  • Based on this map, which of the following
    8·1 answer
  • If a liquid is heated, which of the following happens to both its energy content and the speed of its particles? The energy incr
    13·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • A major distinction between prokaryotes and eukaryotes is the presence of membrane-bound organelles in eukaryotes.
    10·1 answer
  • Are Moon craters the result of volcanoes or impacts?
    11·1 answer
  • Can you think of a scenario in which BMI could be an inaccurate metric?
    14·1 answer
  • Estimating the weight of a dinosaur using only bones is difficult. Another way is by using scale models. The density of a dinosa
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!