1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vedmedyk [2.9K]
3 years ago
13

When a positively charged object moves in the same direction as the electric field, the electric potential energy of the object?

Biology
2 answers:
Papessa [141]3 years ago
7 0

Answer: option 2. increases

Explanation: The work done to move a charge in an electric field is given by:

U = F.d = F d cos θ

where F is the electric force between two charges and d is the distance between two charges and θ is the angle between the direction of force exerted and direction of displacement of charge.

F = q E

Where, q is the charge and E is the electric field.

⇒ U = q E d cos θ

When a positively charge object moves in an electric field in the same direction, θ = 0°, cos 0°= 1

⇒ U = q E d

As the charged object moves, d would increase. Electric field (E) and charge (q) are constant. Hence, the electric potential energy  would increase.

inn [45]3 years ago
3 0
2. Increases
but you might have to double check this
You might be interested in
(GIVING BRAINLIEST!!!!)
Alika [10]

Answer:

windy, cold, long, constant(doesn't set), warmer

Explanation:

3 0
3 years ago
Complete the following analogy
DaniilM [7]
I don’t know but it’s either b or c
4 0
3 years ago
Read 2 more answers
What is the difference between a semi-permeable membrane (parchment paper, cellophane paper, etc.) and a differentially permeabl
WARRIOR [948]
Semi permeable membrane will allow something to pass  through them and something not and it will allow on the basis of size particles
while differentialy permeable will include other factors also other than size and will depend on the need of the cell
this is the main difference between them
hope it helps<span />
7 0
3 years ago
Mutations are not always negative. Explain why this statement is true. Provide two reasons using examples to support your answer
Rainbow [258]
2 examples -
1.) in italy, ( limone ) a unique mutation protects them from developing atherosclerosis,
2.)theres mutation in bacteria too, this mutation allows bacteria to survive in the presence of antibiotic drugs, leading to the evolution of antibiotic-resistant strains of bacteria.
5 0
2 years ago
A man pushes a lawn mower with a force of 200N across 50N meters of his lawn. How much work did the man perform?
krok68 [10]
Work is equal to force times distance or W = Fn x d

In this situation, you would use the following equation:
W= 200N x 50N

W= 10,000N

The man performed 10,000N of work.
3 0
3 years ago
Other questions:
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What is another name for major depressive disorder?:
    13·1 answer
  • PLEASE HELP.... I had the flu and didn't understand the work I got 2 days ago. I said to him on friday that I didn't understand
    9·1 answer
  • Technology has provided methods to recycle all products. True False
    5·2 answers
  • Which of the following shapes is most similar to Earth’s orbit?
    11·1 answer
  • The human body contains structures that are needed for survival, or in the case of vestigial structures, were needed for surviva
    15·1 answer
  • Which bonds are found inside a water molecule, between hydrogen and oxygen?
    11·2 answers
  • How do the condition in the United States change when the jet streams moves to the south
    12·2 answers
  • The simplest and most primitive method of reproduction is what?
    9·1 answer
  • QUESTION 8
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!