1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
3241004551 [841]
3 years ago
8

How many times does 3 go into 92

Mathematics
2 answers:
Fofino [41]3 years ago
4 0
Hello there :)

3 goes into 92 thirty (30) times

Hope this helps and have a wonderful day :)

~Celia
ollegr [7]3 years ago
3 0

To find if 3 goes int 92

we need to divide 92 by 3

Figure of the division attached

The first part is 3 goes 3 times into 9 leaving remainder 0

We are left with 2 to divide

but since 3<2, we add 0 to the quotient and leave the 2 as the remainder

Hence 3 goes 30 times in 92 leaving a remainder of 2

You might be interested in
The equation of a circle centered at the orgin is x^2 + y^2 = 16. What is the radius of the circle
Yuri [45]

Given:

The equation of the circle is:

x^2+y^2=16

To find:

The radius of the circle.

Solution:

The standard form of a circle is:

(x-h)^2+(y-k)^2=r^2              ...(i)

Where, (h,k) is the center and r is the radius.

We have,

x^2+y^2=16

In can be written as:

x^2+y^2=4^2                 ...(ii)

On comparing (i) and (ii), we get

h=0

k=0

r=4

Here, the center of the circle is the origin and the radius is equal to 4 units.

Therefore, the radius of the given circle is 4 units.

7 0
3 years ago
100 points !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! please answer this question my grade needs to be up .
sladkih [1.3K]

Answer:

              Food in space

On earth we have a variety of foods, but we can not  enjoy every  food in space. Do you know why?In space astronauts eat non-delicious food but some people think the other way around. preparing food in space is complicated for many reasons, some are microgravity, some foods are not perfected for space  and some foods do not meet the requirements of space food.

preparing food in space can be very different from earth because of microgravity which makes the food float. According to the text “ no pizza in space” the author states  Soft drinks don't work because of microgravity. soda in space is a bit complicated, Because in microgravity the light gas bubbles won’t rush to the top of the liquid to escape.The bubbles of carbon dioxide in carbonated beverages aren't  floatable in a weightless environment, so they remain randomly distributed throughout the fluid, even after drinking. astronauts can't sprinkle salt and pepper on their food in space,They just float away because of microgravity. Scientists have made space food better than before and they will make space food better in the future for astronauts.

Some foods are not perfected to go to space because of many reasons. Milk is one of the foods that is not perfected and  It is also banned for going into space because milk is dehydrated. According to the text “ No Pizza in Space “ Pizzas have not been perfected yet to go to space.Bread is another food that is not perfected and also banned because the bread crumbs float around, and can fly into an astronaut’s eyes and interfere with important equipment.Ice cream is not perfect to go to space because in space shuttle there is no refrigerator and also scientists  have not made an Ice-cream that can go without a refrigerator.  Scientists are predicting more  food for astronauts as they live longer in space.

Some foods do not meet the requirements of space food because they don't have enough nutrition to provide to astronauts. According to the text “ No Pizza in Space?” the author states that they use caloric requirements based on a World Health Organization equation. The most important thing  in developing space foods is making sure that they are tasty, have good nutrient content, and can be easily prepared. Calorie requirements differ for astronauts.  An astronaut can choose from many types of foods such as fruits, nuts, peanut butter, chicken, beef, seafood, candy, brownies, etc.Scientists ensure the food that astronauts eat provides them with a balanced supply of vitamins and minerals. In the past space food did not have enough nutrients to provide to astronauts and now it has triple the nutrients to give to astronauts.

In conclusion,  preparing food in space is complicated for many reasons, some are microgravity, some foods are not perfected and some foods do not meet the requirements of space food. astronauts need to eat a  Nutritionists diet to remain healthy in space as the discover the secrets of the unknown world  

 

hope it helped

 

Step-by-step explanation:

4 0
3 years ago
Read 2 more answers
What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
Papessa [141]

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

8 0
3 years ago
Read 2 more answers
Can somebody help me ?
attashe74 [19]
Do you know what the question is about
6 0
3 years ago
Write (p^2)^3 without exponents
Vilka [71]

Answer:

p^6

Step-by-step explanation:

We are using rule power to a power. x^2^3 = x^(2*3)

p^6

Hope this helps plz hit the crown :D

5 0
3 years ago
Other questions:
  • this isosceles triangle has two sides of equal length, a, that are longer than the length of the base, b. the perimeter of the t
    6·1 answer
  • Somebody help me with this please .
    12·1 answer
  • How many places do you need to move the decimal to the left to write the
    7·1 answer
  • There are 32 students in Mr. Morgan's math class. One student will be randomly selected to present his/her project.
    8·2 answers
  • Evaluate the expression for the given value of x.<br><br> −6x + 5 for x= −6
    8·2 answers
  • One leg of a right triangle measures 10 inches while the other leg measures sqrt(21) Inches . What is the length of hypotenuse ?
    6·2 answers
  • 9 ( z - 4 ) = 9 solve​
    7·1 answer
  • Simplify the following ,leaving your answer as a surd <br>4/√5+3√125​
    11·1 answer
  • I have two marks more than you do and the sum of both our marks is equal to 14 what are our marks
    6·1 answer
  • Factor by using GCF:<br> 8n3 + 2n2
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!