1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
3 years ago
12

What is a example of evolution

Biology
1 answer:
serious [3.7K]3 years ago
4 0
<span>Examples of Evolution: Evolution is the change over time. These changes may involve all aspects of life including mutation, natural selection, genetic drift, thought and technology.
Examples of animals evolving: </span>
<span>The lizard with extra sticky feet. ... The shrimp that lost its eyes. ... The owls that are changing color. ... The fish that's migrating earlier. ... The bedbugs with super-strength. ... <span>The mouse that's immune to poison. ...
</span></span><span><span>
</span></span><span><span>People do not evolve.
</span></span>
You might be interested in
HELP!!!
PIT_PIT [208]

Answer: C). Extraction

Explanation:

Minerals are the inorganic susbtances obtain from the under surface of the earth crust. They are collectively found in the geosphere of earth.

The mineral formation is a long geomorphic process it does not involve any biological activity. After mineral formation mineral extraction is the next step in the resource cycle.

The extraction process involves mining techniques.

3 0
2 years ago
All of the page please !!!
bazaltina [42]

Answer:

(a) Allow movement in only one plane/direction (that is extension or flexion)

(b) The skeletal system also produces blood cells in their bone marrow

6 0
3 years ago
Read 2 more answers
Respiration links up the simple sugar oxygen with the gas
My name is Ann [436]

Answer:

Respiration links up the simple sugar, <u><em>glucose</em></u><em>,</em> with the gas <u><em>oxygen .</em></u>

Explanation:

In the process of respiration, oxygen is used to breakdown glucose. Water and carbon dioxide are produced due as a result of this reaction. A huge amount of energy, in the form of ATP is also released during this process. ATP is used by almost every cell of the body to carry out normal cellular functions. Energy is mainly stored in the linkage between the second and third phosphate of an ATP molecule.

7 0
3 years ago
What is something an organism needs to live? the letters are srureeoc​
Tomtit [17]

Answer:

food, water, and breathing space

Explanation:

4 0
3 years ago
What structure takes up the majority of the center space within the plant cells
Flura [38]
The central vacuole in a plant cell takes up most of the space. The vacuole stores wastes and nutrients, and also provides support and structure for the cell.
5 0
2 years ago
Other questions:
  • This statue of leshan giant buddha in sichuan, china, is carved directly into the mountainside. the color and texture of the sta
    11·2 answers
  • Why does the DNA double helix have a uniform diameter? a. Deoxyribose sugars bind with ribose sugars. b. Nucleotides bind with n
    9·1 answer
  • Black fur(B) in guinea pigs is dominant over white fur(b). What is the probability of the offspring having white fur in a cross:
    10·1 answer
  • WILL MARK AS BRAINLIEST
    6·1 answer
  • Which is a goal of the Human Genome Project?
    10·2 answers
  • Which of the following statements is/are true concerning peptide bonds? They are the only covalent bond formed between amino aci
    8·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Structures represented in the illustration below are found in the lower epidermis of a plant leaf. The illustration shows the re
    6·1 answer
  • How do the properties of water and the ability to modify the rates of chemical reactions enable living things to carry out funct
    14·1 answer
  • Can someone please help me<br><br> How does DNA of every species change over time?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!