1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dafna11 [192]
3 years ago
14

A marine ecosystem off the California coast consists of leatherback turtles that feed on jellyfish, and killer whales that prey

on the leatherback turtles. Habitat loss and fishing have been identified as the main reasons for the reduced numbers of leatherback turtles, who are on the verge of being declared an endangered species. What would be the first effect on the ecosystem if habitat loss and fishing continue unchecked?
Biology
2 answers:
True [87]3 years ago
8 0
The population of jellyfish would increase and the population of killer whales would decrease
Gnom [1K]3 years ago
8 0

Answer:

If habitat loss and fishing continue unchecked then the leatherback turtles would become extinct soon.

The extinction of a species would affect the entire food chain, that is, it would affect the organism present at a lower trophic level as well as the organisms present at the higher trophic level.

Similarly, the extinction of leatherback turtle affects both jellyfish as well as killer whales.  

The population of jellyfish would increase in absence of their predator.

In contrast, the population of killer whales would decrease due to absence or decrease in their prey or food.

You might be interested in
The action potential spreads through an axon by Group of answer choices depolarizing adjacent membrane to threshold, triggering
Step2247 [10]

The action potential spreads through an axon by depolarizing adjacent membrane to threshold.

  • K+ departs the cell after Na+, which enters the cell first. Ions can move freely across the axon membrane because of the difference during the action potential.
  • Because sodium contains a positive charge, the neuron becomes more positive and depolarized. Potassium channels take longer to open. As soon as the cell does open, K+ rushes out, reversing the depolarization known as repolarization.
  • Sodium channels close during the peak of the action potential when potassium leaves the cell. When potassium ions are effluxed, the membrane potential is lowered or the cell becomes hyperpolarized.
  • Outside of the cell, the concentration of Na+ is greater than inside the cell. while the concentration of K+ is  is greater inside the cell than outside.

learn more about action potential here: brainly.com/question/6705448

#SPJ4

4 0
1 year ago
_trophs often make their own food using sunlight,
Alja [10]

Answer:

Autotrophs

Explanation:

Hope this is helpful

5 0
2 years ago
What are two characteristics of bryophytes?
svetoff [14.1K]
Absence of true roots stems and leaves
4 0
3 years ago
Read 2 more answers
How does energy flow through organisms in an ecosystem
nlexa [21]
C from the sun to bird to worm
6 0
3 years ago
The Arctic Fox has a gene that regulates fur color. In warm summers, the gene for brown fur color is activated. In cold winters,
hoa [83]
Jdhdjdsuhdududovggfggggtcgicyic
6 0
2 years ago
Other questions:
  • Where do most phosphates and nitrates in the Chesapeake Bay come from?
    11·2 answers
  • Chelsea is a toddler who has authoritarian parents. her parents do not allow her to make any decisions on her own. as a result,
    12·1 answer
  • Frogs go through metamorphosis.<br> a. True<br> b. False
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • You observe a sample under a microscope. It is 200 µm in diameter and has no nucleus. What would it most likely be?
    9·1 answer
  • What is a positive symptom of schizophrenia?
    12·1 answer
  • Which best describes the effect on weather in an area if low clouds cover the sky during the daytime?
    11·1 answer
  • Hey everyone I need some help. Base your answer to the following question on the diagrams below which represents two different c
    13·1 answer
  • In what ways is a mineral reserve different from a mineral resource
    5·1 answer
  • In a particular population the allele frequency of the abo blood type alleles are as follows: ia is 40%, ib is 30%, and i is 30%
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!