1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vagabundo [1.1K]
3 years ago
11

All atoms of the same element contain the same number of

Biology
1 answer:
Luda [366]3 years ago
5 0

Answer: The answer is B while neutrons and electrons are usually the same in a given atom protons are always consistent.

You might be interested in
Your 1 st section should be about reproduction in humans.
jekas [21]

The human reproductive system is different in males and females. When a sperm and egg join, the egg is fertilised and a baby starts to develop. Its mother provides all a baby’s needs until it is born.Fertilisation happens when an egg cell meets with a sperm cell and joins with it. The fertilised egg divides to form a ball of cells called an embryo. The embryo attaches to the lining of the uterus. It begins to develop into a fetus and finally into a baby.The mother’s lifestyle can affect the developing fetus. For example, smoking reduces the amount of oxygen in the bloodstream. This can lead to low birth weight and premature birth (when a baby is born too soon). Drinking alcohol during pregnancy can harm the developing baby’s nervous system, especially its brain.

Birth

It takes about 40 weeks for a baby to develop in the uterus. This time is called gestation. After this, the baby is ready to be born. The cervix relaxes and muscles in the wall of the uterus contract. Waves of muscle contraction push the baby out of the mother's body through the vagina.

4 0
3 years ago
What part of the chromosomes do the spindle fibers attach to in order to move the chromosomes around?
tino4ka555 [31]

Answer:

Spindle fibers move chromosomes during cell division by attaching to chromosome arms and chromosome centromeres. A centromere is a specific region of a chromosome where duplicated chromosomes are joined. The identical, joined copies of a single chromosome are known as sister chromatids. The centromere is also where specialized protein complexes called kinetochores are found.

Explanation:

8 0
3 years ago
What does the term strain mean as it is used in genetic crosses
LUCKY_DIMON [66]

In biology, the strain is a low-level taxonomic rank used in different contexts:

In microbiology, a strain is a part of a bacterial species different from other bacteria of the same species by a minor but identifiable difference. Strains are often created in the laboratory by mutagenesis existing strains or wild-type examples of bacterial species.

In zoology, a strain corresponds to an individual or group of individuals who are at the origin of a line of descendants, sometimes called the holotype, paratypes, etc. A strain is a population of organisms that descends from a single organism or pure isolate culture. Strains of the same species may differ slightly from each other in many respects.

A strain thus consists of a group of organisms of the same species possessing certain differential traits based on their relationship; either they come from the same region, as the same watershed of a river, or they are the fruit of a particular breeding program (exists as a whole interbreeding without introductions from external sources).

5 0
3 years ago
A woman treated her home with a pesticide that kills spiders. The first application killed 78% of the spiders. Two months later
gizmo_the_mogwai [7]
The spiders have became resistant to the pesticide.
8 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Read the sections titled “Retaining Water” and “Acquiring Water.” Explain how desert animals retain and acquire water in such a
    7·2 answers
  • List the senses used when observing a person
    14·2 answers
  • What are the maximum number of covalent bonds an element with atomic number 16 can make with hydrogen?
    10·1 answer
  • 1. How do plants on Earth affect the amount of carbon in Earth’s atmosphere?
    7·1 answer
  • NEED HELP ASAP!!
    12·2 answers
  • Conducting experiments, using inquiry, and asking testable questions are processes that are used by
    7·1 answer
  • In fall, chlorophyll is the first pigment to disappear from dying leaves? Using what you have seen today, and specific vocabular
    13·2 answers
  • Do you think chickens and other birds can be descendants of other dinosaurs?
    13·1 answer
  • I'm learning about photosynthesis and cellular respiration and wonder how cellular respiration works for plants.
    13·2 answers
  • Which amino acid might be expected to have the least effect on the function of an enzyme if it replaces a glu residue in the enz
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!