1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vfiekz [6]
3 years ago
15

The absorption of carbon dioxide from plants can be analyzed via satellite as shown in the image below. In the image below, gree

n represents land areas where carbon dioxide is being absorbed, and blue represents sea areas where carbon dioxide is being absorbed. The darker the color, the more carbon that location absorbs each year.
What can you conclude about the location of the dot?
There is little carbon being released.
The carbon is sinking into long-term storage.
The carbon is causing climate change in this zone.
There is a forest where many trees are absorbing carbon.

Biology
2 answers:
bezimeni [28]3 years ago
8 0

It os being absorbed by the sea make it a long term because its a long process

olya-2409 [2.1K]3 years ago
5 0

Answer:

The carbon is sinking into long-term storage.

Explanation:

The area of the dot represents hydrosphere or water body of the earth such as the ocean. The ocean is a great absorber of carbon dioxide (CO₂) from the atmospheric air. One fourth which humans create by burning fossils fuels such as coal, petroleum, natural gas. In normal condition, ocean water is slightly alkaline but due to absorption of more CO₂, ocean water becomes more acidic in the long term. The alkalinity of the ocean is very important in maintaining a delicate balance needed for marine animals.    

You might be interested in
A germ line mutation can have what possible outcome on the progeny (offspring)?
nikklg [1K]

Answer:

A germline mutation, or germinal mutation, is any detectable variation within germ cells (cells that, when fully developed, become sperm and ovum). Mutations in these cells are the only mutations that can be passed on to offspring, when either a mutated sperm or oocyte come together to form a zygote.

Explanation:

4 0
2 years ago
The mass of some corn plants at the end of their growth period was 6 tons per acre. Most of this mass was produced from?
Aleksandr [31]
<span>The majority of mass of any plant is produced from water from the soil and carbon dioxide with sunlight from the air. 6 CO2 + 6 H2O + sunlight ---> C6H12O6 + 6 O2 ... The gluclose (C6H12O6) is a simple sugar that becomes the biomass of the plant. Other minor contributors to the mass are from fertilizers (mostly N, P, and K) and minerals.</span>
8 0
3 years ago
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
2 years ago
POINTS if yall want them
kobusy [5.1K]

Answer:

YESSSSS

Explanation:

PLz mark Brainlest TO

7 0
3 years ago
Read 2 more answers
Ca someone help me pls
12345 [234]
1.Matter
5.Compound
That's all I could read
5 0
3 years ago
Other questions:
  • PLEASE ANSWER THESE QUESTIONS COMPLETELY!!! WILL MARK BRAINLIEST!!!
    14·1 answer
  • Why/ how does dna become more compact
    14·2 answers
  • In a heliocentric model, Earth and the other planets orbit a central star, known as the sun.
    5·1 answer
  • Crossing over occurs during which phase of meiosis
    15·1 answer
  • Hydrogen has three isotopes 1H, 2H, and 3H. What is the difference between these three isotopes?
    9·2 answers
  • Does fab laundry detergent contain enzymes
    10·1 answer
  • An organism has the following traits:
    9·1 answer
  • In the diagram, which represents a catalyst?
    14·1 answer
  • If I slept next to my Alexa all night, will it damage my brain a lot after doing this for a month?
    5·2 answers
  • What is segregation in biology​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!