Answer:
A germline mutation, or germinal mutation, is any detectable variation within germ cells (cells that, when fully developed, become sperm and ovum). Mutations in these cells are the only mutations that can be passed on to offspring, when either a mutated sperm or oocyte come together to form a zygote.
Explanation:
<span>The majority of mass of any plant is produced from water from the soil and carbon dioxide with sunlight from the air. 6 CO2 + 6 H2O + sunlight ---> C6H12O6 + 6 O2 ... The gluclose (C6H12O6) is a simple sugar that becomes the biomass of the plant. Other minor contributors to the mass are from fertilizers (mostly N, P, and K) and minerals.</span>
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
1.Matter
5.Compound
That's all I could read