1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maria [59]
3 years ago
8

Explain how many cells are produced from one fertilised egg, after two cell divisions by mitosis

Biology
1 answer:
nikklg [1K]3 years ago
4 0
Human sperm and eggs contain 23 chromosomes. Human zygotes contain 46<span> chromosomes. The type of cell division that produces gametes with half the normal chromosome number is called meiosis. It is used to produce cells for repair and asexual reproduction.</span>
You might be interested in
Why does amino acids decrease in ileum​
ASHA 777 [7]

Answer:

The two major pancreatic enzymes that digest proteins in the small intestine are chymotrypsin and trypsin. Trypsin activates other protein-digesting enzymes called proteases, and together, these enzymes break proteins down to tripeptides, dipeptides, and individual amino acids.

5 0
3 years ago
What are frankenfoods? Are Genetically Modefied foods safe?
barxatty [35]

Opponents of GMOs have been unceasing in their campaign to vilify genetically modified foods by describing them as “Frankenfoods,” thus implying they are not natural and are potentially harmful.

“The practice of introducing new DNA and chemicals to seeds or animals (Aqua Advantage has developed a GMO fish) is similar to how Mary Shelly’s Frankenstein created his monster–—through piecing together lots of different organisms,” wrote the Organic Authority on its website—a common allusion in the anti-GMO world. “We all know what happened when the monster turned on Frankenstein, and many critics of genetic engineering have likened the inevitable backlash of GMO technology to the destruction and murderous rampage of Frankenstein’s monster.”

Many anti-GMO articles that warn of the dangers GM crops are often accompanied by an image of a tomato fruit or vegetable with syringes sticking out of them. Very often it is a fruit or vegetable for which there is no current GM equivalent such as a tomato. This depiction is used to reinforce the notion that GM foods are created in laboratories and not by nature and therefore are dangerous to consume.

With the constant barrage of scare-based imagery, it is not surprising that there is widespread public suspicion that GMOs are dangerous to human health. But there is little controversy surrounding GMOs within the scientific community with 88 percent of the members of the American Association for the Advancement of Science believing GMOs are “generally safe.” The safety of GMOs were once again reinforced by the May 2016 report by the U.S. National Academy of Sciences, Engineering and Medicine, which concluded, there was “reasonable evidence that animals were not harmed by eating food derived from genetically engineered crops”, and epidemiological data indicated there was no increase in cancer or other health related problems associated with these crops entering our food supply.

David Zilberman, a professor of agriculture and resource economics at the University of California, Berkley, has noted that Frankenfood was “a terrible word, a stigmatization word, one that’s used to scare people… People are afraid of GMOs for little or no reason. GM is simply a tool. Because it allows us to modify plants with far greater precision and control then before, it will be very valuable.”

The reality is that the vast bulk of the foods we consume whether organic or conventionally grown have had their genetics altered in the field or in a laboratory via a process of selective breeding or advanced biotechnology techniques, and all such foods are safe to eat. The altering of genes in plants is even known to occur naturally as highlighted by the sweet potato.

6 0
2 years ago
Write a title for each step of primary<br><br> succession
vladimir2022 [97]

Answer:

<em>The labels <u>I-VII</u> represent the different stages of primary succession. I-bare rocks, II-pioneers (mosses, lichen, algae, fungi), III-annual herbaceous plants, IV-perennial herbaceous plants and grasses, V-shrubs, VI-shade intolerant trees, VII-shade tolerant trees.</em>

4 0
2 years ago
Help me!!!!!!!!!!afsjfjdbsbhxx
Bess [88]

Answer:

equivalent resistance = R1R2/R1+R2

= 30/13 ohm

V = IR

= 5×30/13

V = 150/13 ohm

8 0
3 years ago
Why all vertebrae are bones but all bones are not vertebrae?
omeli [17]
Vertebrae are the scientific term for the backbones. 
All backbones are backbones... right? :'D 

However, the vertebrae are only a bone GROUP; there are other types of bones like joints, shafts and etc which don't come under the vertebrae clssification. 
6 0
3 years ago
Other questions:
  • Identify and describe the soil found in the tundra
    13·1 answer
  • Which of the following was an early realization that gave rise to Darwin's theory of natural selection?
    14·2 answers
  • Describe one specific reason why scientists would want to maintain the genetic makeup of a particular plant?
    10·1 answer
  • Help me we are almost through we got the first one we need two <br> More
    5·1 answer
  • In what ways could globalization possibly impact negatively and/or positively your current or future work environment.
    5·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Displacement distance wave graphs can be used to determine the​
    15·1 answer
  • No Light<br> Yo =<br> Gas<br> Gas<br> Water<br> Plant
    9·1 answer
  • What is the best explanation for the faster times of the group fed a pre-race meal of bread with bananas and honey
    7·1 answer
  • After eating your favorite candy bar, you noticed that you have a sudden burst of
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!