1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katyanochek1 [597]
3 years ago
11

Which of the following is not common to both prokaryotic and eukaryotic cell division?

Biology
2 answers:
julsineya [31]3 years ago
3 0

The correct answer is: A checkpoint will be activated if the spindle does not attach to a kinetochore.

Prokaryotes, do not undergo mitosis (like eukaryotes) and therefore have no need for a mitotic spindle. Prokaryotes also don’ t have checkpoints foor the regulation of cell division.

Normal eukaryotic cells (unlike cancer cells), move through the cell cycle in a regulated way in order to make sure that cells don't divide under conditions that are unfavorable for them. Information about their own internal state (nutrients, signal molecules, DNA integrity) is signal to go or not to go through the cell division. Because of that there are few checkpoints in the cell cycle at which the cell examines the signals and makes a “decision”. The major checkpoints are:

• The G1- the first point at which it must choose, once it passes the G1 checkpoint the cell enters S phase

• The G2-the cell checks DNA integrity and checks if replication is done well.

• The spindle checkpoint-at the transition from metaphase to anaphase.

alexira [117]3 years ago
3 0

The correct answer choice for the problem is A checkpoint will be activated if the spindle is not attached to the kinetochore.

<h2>Further explanation </h2>

Cell division is a process in which stem cells divide or divide themselves into 2 or more daughter cells. Cell division is a part of our body. We grow because the cells in our body divide.

In the cell cycle, there are two stages, namely interphase, and M-Phase. The interface is the stage where cells do not divide. This phase lasts for 15 hours and there are 3 stages, namely G1 Phase (duplicate cell organelle phase), S-Phase (DNA replication phase), and G2 Phase (phase of cell growth and protein synthesis). It is in the M-Phase stage that the cell begins to divide. This lap only lasts 2 hours and consists of the karyokinesis and cytokinesis processes. Kariokinesis is the stage where the process of cell nucleus division through the ProMAT stage, while cytokinesis is the stage of cytoplasmic division. Cell division is divided into 2 types according to the type of cell dividing, namely division in prokaryotic cells and eukaryotic cells.

<em>1. Cleavage in Prokaryotic Cells </em>

Cleavage in prokaryotic cells is known as binary division, which means this division takes place simply and spontaneously. This cleavage process is also known as the amitotic cleavage process. Amitosis means division that does not involve chromosomes. Binary division can be found in bacterial cells, cell growth processes, duplication of genetic material, chromosome division, and cytoplasmic division.

In binary fission, the chromosomes are duplicated and will stick to the plasma membrane. Then there will be growing between the two attachment sites of the chromosome. This is to do a core separation. Cytokinesis and cell wall formation are then formed so that 2 daughter cells are formed.

<em>2. Eukaryotic Cell Cleavage </em>

Cell division in eukaryotic cells is divided into meiosis and mitosis.

Mitosis

Mitosis division is a division that produces daughter cells that can divide again. The mitotic division produces two daughter cells that are identical to the parent.

Meiosis

The meiotic division is a division that produces gametes. This gamete cannot divide again until fertilization.

Learn more

Mitosis and miosis brainly.com/question/853697, brainly.com/question/2558664

Details

Class: Hight School

Subject: Biology

Keywords: Prokaryotic and eukaryotic cell division.

You might be interested in
Please help me out.​
aniked [119]

Answer:_____________

Explanation:_____________

6 0
3 years ago
Name the organ that is adapted for gaseous exchange in humans
maw [93]

Answer:

Lungs.

Explanation:

Lungs are the organs that are responsible for gaseous exchange in humans. The lungs absorb oxygen from the air that is required for the process of respiration while on the other hand, carbon dioxide is transferred from the cells to the lungs through blood because carbondioxide gas is a waste material that is produced during respiration so it can be removed from the body with the help of lungs..

4 0
3 years ago
What kind of channels are located in the input region?
tamaranim1 [39]

Answer:

The correct answer is option B ( ligand gated channels opened by neurotransmitter molecules).

Explanation:

Input region or postsynaptic region or dendrite is the site of neuron cell which receives the impulse from the pre-synaptic neuron at the synaptic junction.

The cell membrane of the dendrite is embedded with ligand-gated channels which opens up in response to the ligand (neurotransmitters) produced by the neurotransmitter vesicle of axon or output region of neuron.

The neuromuscular junction is such a case where acetylcholine receptors present in the dendrite opens in the presence of acetylcholine.

Thus, option B ( ligand-gated channels opened by neurotransmitter molecules) is the correct option.

8 0
3 years ago
Describe the events that might occur if there isn’t new crust formed.
ipn [44]

Oceanic crust is constantly formed at mid-ocean ridges, where tectonic plates are tearing apart from each other. As magma that wells up from these rifts in Earth's surface cools, it becomes young oceanic crust. ... Just as oceanic crust is formed at mid-ocean ridges, it is destroyed in subduction zones.

8 0
3 years ago
What is the meaning of respiration​
Nookie1986 [14]

Answer:

in physiology respiration is the movement of oxygen from the outside environment to the cells with tissues and the removal of carbon dioxide in the opposite direction .. in contrast exhalation is usually a passive process

<em><u>hop</u></em><em><u>e</u></em><em><u> it's</u></em><em><u> helpful</u></em>

7 0
3 years ago
Read 2 more answers
Other questions:
  • 5)
    8·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Function Golgi apparatus ​
    8·1 answer
  • Why do scientists classify organisms?
    7·1 answer
  • Punnett squares use mathematical probability to help predict the genotype and phenotype combinations in genetic crosses. Select
    8·1 answer
  • What does it mean to say something “radiates”?<br><br><br>Explain your answer.
    11·2 answers
  • Which of the following describes the interaction between a virus and a cell?
    6·1 answer
  • Tiny blood vessels called ____ Connects the very small artery branches to very small veins. PLESE HELP FAST
    11·2 answers
  • Spores and seeds have basically the same function-dispersal-but are vastly different because spores ________. (A) have a protect
    13·1 answer
  • a lion and a leopard have almost the same characteristics in terms of feeding habitat and behavior . explain why a leopard and c
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!