Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer:
The annelids (Annelids, from Latin anellus, "little ring"), also known as the ringed worms or segmented worms, are a large phylum, with over 22,000 extant species including ragworms, earthworms, and leeches.
Explanation:
Rank: Phylum
Organism classification: Leech
Displayed higher classification: Animal
Essential amino acids cannot be made by the body. As a result, they must come from food. The 9 essential amino acids are: histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine.
Both represent physical weathering.
Answer:
in explanation
Explanation:
I'd say one species can become two different species by mating. If one species mates with a different species than they carry their genes over to the baby. This would become a repeating cycle making another species.
I don't know if this was the answer you were looking for, but this how animal breeders get a certain type of animal.
