1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivanzaharov [21]
3 years ago
10

Which of these organisms lacks nervous tissue? A. sponge B. jellyfish C. nematode D. earthworm

Biology
2 answers:
chubhunter [2.5K]3 years ago
7 0
The answer is A. Sponge.
NikAS [45]3 years ago
5 0

The correct answer is A. Sponge

Explanation:

The nervous tissue is one of the types of tissue; this tissue is mainly composed of neurons that transmit and receive electrical signals; additionally, the main function of the nervous tissue is to control movement and process signals, besides it regulates some functions such as digestion. This tissue can be found in most organisms from mammals and complex organisms to worms.

However, in the case of sponges, these do not have nervous tissue as these are a simple multicellular organism that relies on filtering water for most functions and does not require a system for transmitting signals or moving. Also, besides lacking a nervous system, sponges do not have a digestive, and circulatory system.

You might be interested in
Why do elements of the same group have the same chemical properties?
PtichkaEL [24]
They have the same number of valence electrons on the outer most shell
4 0
3 years ago
Recently, a human trachea ( a respiratory organ) was produced by using a patient's own stem cells. The benefit of using the pati
BigorU [14]

Answer:

3

Explanation:

7 0
3 years ago
The ATP made during glycolysis is generated by :
ASHA 777 [7]

Answer:

The correct answer is A. Substrate-level phosphorylation

Explanation:

During the substrate-level phosphorylation, phosphoryl group is directly added to ADP or GDP to form ATP or GTP from phosphorylated intermediate rather than from inorganic phosphate like in case of oxidative phosphorylation.

So in glycolysis 4 ATP are produced by substrate-level phosphorylation. Apart from the 4 ATP, 2NADH are also produced during the glycolysis which is used during the oxidative phosphorylation and produce 4-6 ATP.

So ATP made during glycolysis is generated by substrate-level phosphorylation as ATP is produced by direct addition of phosphoryl group from intermediates.

3 0
3 years ago
1. The study of food intake and its effects upon the body is called ____.
Ghella [55]

Answer:

Nutrition

Explanation:

Nutrition is the study of diet and its relation to health. Those that specialize in this type of study are dietitians. It is considered a science that deals with what we eat and how it affects our bodies. They study things like how deficiencies, excesses or imbalances of certain foods or food components (i.e. minerals, vitamins, nutrients, etc.) relate to overall health as the state of any of these may result in a disorder or disease. They not only determine cause but they also help in developing interventions to help treat patients with different diet-related diseases; and help in developing preventive measures.

The role of nutrition as a study is imperative because essentially, we are what we eat. What we consume on a regular basis contributes to the efficiency of the functions of our body. The food we eat can have an effect on the body not only in the organ level, but even on the cellular level, as our cells rely on the food we eat and drink for energy to function.

8 0
3 years ago
Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
Tomtit [17]

Answer:

I'll break this into threes so its easier to read;

TTC ATG CTA GCT ACG TGT ACG TAC CGA TGC G

Explanation:

In DNA, the A bases goes with the T bases, and the C bases go with the G bases.

3 0
4 years ago
Other questions:
  • Abundant and powdery pollen produced by small, indistinct flowers is probably transported by:
    10·1 answer
  • ___ specifically depletes populations of commercial fish species, and is a major threat to marine systems from human activities.
    14·2 answers
  • Help on these 4 questions asap
    8·1 answer
  • Please Help me with Question 14 and 15
    13·1 answer
  • What is the meaning of Gago ka?<br><br>No stupid answer or else I report you!!!!!<br><br>​
    12·2 answers
  • what is the color of a mirror???? but dont uses google or a will be delete yout anserw because is not he google ansewr
    11·2 answers
  • For brainliest ! 3-4 sentences ofc i'm gonna put whatever you write in my own words .
    8·1 answer
  • What is your opinion about extrasensory perception? Do you think it exists? Explain your answer.
    12·1 answer
  • What would happen to the number of organisms at each level of the pyramid starting from the base?
    8·1 answer
  • True or false? An organism that is better suited to the environment is more likely
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!