1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Travka [436]
3 years ago
14

The young hatchlings landed on the gray, rocky shore of the crashing sea.

Biology
2 answers:
Mariana [72]3 years ago
6 0
The adjective that comes from a verb form is the word crashing.
It comes from the verb <em>to crash + -ing, </em>thus it is a participle used as an adjective in this sentence.
Novosadov [1.4K]3 years ago
4 0

Answer:

crashing

Explanation:

the "ing"

You might be interested in
a puppy has long floppy ears like his mother and dark brown for like his father how did the puppy get these traits
hammer [34]

Answer:

genes

Explanation:

the puppy got half their mother's chromosomes and half their dad's chromosomes therefore inheriting parts of their genes

5 0
3 years ago
some of the bacteria in the human gut do not survive well outside that environment, and produce vitamin k among other nutrients.
pishuonlain [190]
Commensalism :)
in case when bacteria and human, both are benifited.
5 0
3 years ago
4. Lily is studying the core of Earth. Which sphere is she examining?
erastovalidia [21]
Lithosphere is the anwser
5 0
3 years ago
Read 2 more answers
Glucose-6-phosphate dehydrogenase deficiency (G6PD) is inherited as an X-linked recessive allele in humans. A woman whose father
prohojiy [21]

Answer:

(a) 1/2; (b) no

Explanation:

Glucose-6-phosphate dehydrogenase deficiency (G6PD) is an X-linked recessive disorder and the woman's father was diseased so it means that woman is a carrier of the allele but has normal phenotype. It means that she will have XXᵇ genotype.

In contrast to this, her husband is diseased so his genotype will be XᵇY.

The Punnett square diagram related to the cross is attached.

(a) Proportion of their sons expected to be G6PD is 1/2:

They both may give birth to 4 progeny with genotypes XXᵇ, XᵇXᵇ, XY and XᵇY. It means they both may have 2 sons out of which one with genotype XᵇY will be diseased while the one with genotype XY will be healthy. So the proportion of their sons having G6PD is 1/2 or 50%.

(b) If the husband were G6PD deficient, the answer will not change.

The reason behind this is that this disease is caused by an allele located in X chromosome. But father contributes only Y chromosome to his son not X chromosome. The X chromosome will affect the genotype of his daughter not son that is why answer will not change. It means they will still have 1/2 of their sons diseased.  

7 0
3 years ago
What is true of a substrate?
Ksivusya [100]

It acts as a reactant in a chemical reaction.

6 0
3 years ago
Other questions:
  • Chinchillas
    11·1 answer
  • Which of the following is considered a sexual process for exchanging genetic information but is not considered reproduction?
    13·1 answer
  • _____________ lie close to the nucleus. they are rod shaped bodies that lie at right angles to each other; internally they are m
    15·1 answer
  • What is found not only in bones and teeth but also in all body cells as part of a major buffer system, and is found in almost al
    5·1 answer
  • Why do males have some of the female sex hormones? Why do females have some of the males sex hormones
    15·2 answers
  • For a substance to change from a liquid to a solid what must happen to its particles?
    5·2 answers
  • The valve that is located between the right atrium and right ventricle is the ____________.
    6·1 answer
  • Please explain me what about osmosis!
    10·2 answers
  • What do you predict would happen if hydrogen bonds formed between any two nitrogenous bases in DNA ?
    15·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!