1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Virty [35]
3 years ago
8

What plants in the rainforest do animals eat?

Biology
1 answer:
kiruha [24]3 years ago
8 0
All that produce fruits
You might be interested in
What would occur if cells were in mitosis more than they were in interphase?
steposvetlana [31]
Mitosis is the cell division process that occurs anywhere in the body, these except the production of the gametes. 
If the cells were more in the mitotic process then the cells would only keep dividing in an amassing rate. This might cause some genetic errors and dysfunctions. 
6 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
The energy stored in ATP is released when a_______is removed from the molcecule?
allsm [11]
When a phosphate group is removed from the molecule
6 0
3 years ago
Genes are segments of DNA that determine the phenotype of an individual. Pea colors can be yellow or green. When two plants that
telo118 [61]

The answer to question 1 is A.

The answer to question 2 is C.

6 0
3 years ago
Read 2 more answers
What is the difference between asexual and sexual reproduction?
dalvyx [7]
One is were you bang someone else to reproduce and the other is where you bang yourself to reproduce
7 0
3 years ago
Other questions:
  • A student drew the following flowchart to show the movement of nutrients through Earth's spheres
    5·2 answers
  • Question 5
    6·1 answer
  • Two isotopes of the same element must have the same
    7·1 answer
  • Which in an area located within the alpine tundra
    6·1 answer
  • What term is defined as the basic unit of structure and function found in all living things?
    7·2 answers
  • What is Speciation?
    6·1 answer
  • If a haploid cell has 20 chromosomes, how many chromosomes would be found in the diploid cells?
    13·1 answer
  • Describe how the organization of a multicellular organisms helps it function.​
    11·1 answer
  • Which organelle is found in plant cells only? A.7 B.1 C.3 D.6
    8·1 answer
  • For "Ocean to Continent" Convergent Plate Movement, Describe what is happening and the Geological result
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!