1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AVprozaik [17]
3 years ago
16

Genes are segments of DNA that determine the phenotype of an individual. Pea colors can be yellow or green. When two plants that

produce yellow peas were crossed, the offspring produced green peas. This is because the parents were _______
a)heterozygous
b)homozygous dominant
c)homozygous recessive

for pea color. Because there are only two options for pea color, the plants’ pea color is a case of____-

a)polygenetic traits
b)semiconservative replication
c)simple Mendelian genetics

Biology
2 answers:
Otrada [13]3 years ago
7 0

Answer: The correct answer for the blanks are-

1) a) heterozygous

2) c) simple Mendelian genetics

Explanation-

1) As per the information given in the question, the two plants with yellow pea are crossed and produced offspring with green peas. This indicates that yellow pea color is a dominant trait and the parent plants have heterozygous dominant genotype ( Yy).

A dominant trait ( represented by capital letter allele such as 'Y' for yellow peas) always masks the expression of recessive trait ( which is represented by small letter allele such as 'y' for green peas).

Yellow pea can have two genotypes, which are 'YY' (homozygous dominant and 'Yy' (heterozygous dominant) whereas green peas will be expressed in single genotype, which is 'yy' ( homozygous recessive).

Two yellow peas can produce green peas only when they possess heterozygous genotype (Yy) that is with two different alleles.

Thus, option a) is right for first question.

Refer punnet square.

2) According to simple Mendelian genetics, a trait is governed by single gene that exist in two different forms ( dominant and recessive allele).

It expresses only two forms for a trait ( such as tall and dwarf height of pea plant) and there is no range/ variation of phenotype in between ( unlike polygenic trait that is depicted by many genes and show range of variations in the phenotype such as skin color).

Thus, option c) is the right answer for the second question.

telo118 [61]3 years ago
6 0

The answer to question 1 is A.

The answer to question 2 is C.

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
What is an observation
vagabundo [1.1K]
Hello!

Could be either:

<span>The action or process of observing something or someone carefully or in order to gain information.
</span>
Or 

<span>A remark, statement, or comment based on something one has seen, heard, or noticed.
</span>
And in Science:

 <span>An 'observation' in the scientific sense, is when you make a measurement or evaluation of some sort. You would usually make a note of how something has changed sine the previous ovbservation. Maybe the temperature has changed: gone up one degree; or a crystal has grown: maybe it is now .1 centimeters longer. 

"Observations" usually implies that you are watching some process, and either measuring or noting the change that has taken place. usually you will also want to note the time of the observation, so that you can have an idea of how quickly (or slowly) the changes are occurring.
</span>

Hope this All Helps (Hope it did)! Have A Wonderful Day! :)
4 0
3 years ago
The binding of a neurotransmitter on a postsynaptic cell allows potassium ions to diffuse out of the cell. this would result in
xxMikexx [17]

Answer:

The binding of a neurotransmitter on a postsynaptic cell allows potassium ions to diffuse out of the cell. This would result in a NEGATIVE CELL MEMBRANE POTENTIAL which is an HYPERPOLARIZATION event.

Explanation:

The binding of a neurotransmitter to a postsynaptic cell results in a group of channels in the cell membrane called ligand gated channels open or close in response to that binding.

Hyperpolarization occurs when a ligand gated channel opens and allows potassium ion to flow out of the cell.

During hyperpolarization, potential of the cell membrane experience changes which makes it to become more negative.

4 0
3 years ago
What causes planets movement
swat32

Answer:the planets are moving sideways.

Explanation:

6 0
3 years ago
What inferences can you make regarding the ph of a particular part of the digestive system and the type and relative size of the
jekas [21]
From the data of pH, the type <span>and relative size of the carbon-based molecules, you can relate these to determine at which levels that a certain carbon-based molecule. Hope this answers the question. Have a nice day. Feel free to ask more questions.</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • How do biozones help scientists? Choose all that apply. A) The relative age of the rock can be determined by the types of fossil
    8·1 answer
  • the blood cells that contain a red pigment called hemoglobin for bringing oxygen to the cells of the body are the
    9·1 answer
  • What is the difference between a heterogeneous mixture and a homogeneous mixture? A. A heterogeneous mixture can only be a solid
    8·1 answer
  • a 4.24 kg marble slab has a volume of 1564 cm^3. what is it's density in g/cm^3? give you answer to the nearest tenth
    9·1 answer
  • These cells are part of the domains Archaea and Bacteria. prokaryotes eukaryotes
    5·2 answers
  • In humans, the agent responsible for the greatest number of cancers is _____.
    5·1 answer
  • please help me please help me please help me please help me please help me please help me please help me please help me please h
    15·1 answer
  • Oxygen-poor blood flows out of the heart and into the lungs. Nutrients and oxygen are sent to other cells and parts of the body.
    9·1 answer
  • Hi, I need help with this I don't really understand :[
    5·1 answer
  • By which time period did the average
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!