1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
3 years ago
11

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Biology
1 answer:
liubo4ka [24]3 years ago
8 0

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

You might be interested in
Page 161 3. how do people adapt to environmental extremes and other circumstances? human populations that engage in activities t
PilotLPTM [1.2K]
It’s true (a) because bones become brittle and easier to break if theyre not used. bones more frequently used become stronger.
7 0
4 years ago
Cellulose belongs to a group of molecules called
lubasha [3.4K]
I think the answer you're looking for is Carbohydrate
3 0
3 years ago
Read 2 more answers
If the muscles in your body were to stop functioning properly, what other body system(s) could be affected? Question options:
tamaranim1 [39]
Circulatory system because, movement causes circulation and movement is only possible by our muscles.
8 0
3 years ago
The formation of soil is primarily the result of
otez555 [7]

Answer:

can you give me more information

8 0
3 years ago
Read 2 more answers
About 140,000 Japanese died in this Japanese city when Americans dropped an atomic bomb at the end of World War II.
Black_prince [1.1K]
Hiroshima is the Japanese City where 140000 people died when Americans dropped an atomic bomb at the end of the World War
5 0
4 years ago
Other questions:
  • What are the three parts of an atp molucule
    7·1 answer
  • Two different species of bacteria are examined. scientists find that species x always produces co2 and h2o during cellular respi
    8·1 answer
  • "one shift in activation that occurs as children develop is from diffuse, larger areas to more focal, smaller areas. this shift
    15·1 answer
  • Which of these statements is true concerning the hepatitis a virus (hav)?
    8·1 answer
  • What steps can someone take to prevent or treat H1N1 influenza?
    5·2 answers
  • Which of the following is not true about a systematic approach to anatomy
    10·2 answers
  • What is an example of something that exist in natural systems?
    15·1 answer
  • What are genetically modified crops?
    12·2 answers
  • What is the process called when molecules in a living organism are broken down and built up​
    5·2 answers
  • The process of photosynthesis take place in the
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!