1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
3 years ago
11

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Biology
1 answer:
liubo4ka [24]3 years ago
8 0

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

You might be interested in
What is membrane biogenesis?Answer in detail
saw5 [17]
Membrane biogenesis is the process which involves the synthesis of cell membrane with the help of proteins and lipids.
7 0
3 years ago
Which of the following is not a problem associated with dams?
pogonyaev

Dams are not associated with economic advantages.


Dams DO associate with changes to waterway ecosystems, siltation behind the dam, and dam maintenance and breajs,

5 0
3 years ago
Name the possible ways that diseases are spread. Describe how this happens in communities.
Ilia_Sergeevich [38]
Some ways in which communicable diseases spread are by: physical contact with an infected person, such as through touch (staphylococcus), sexual intercourse (gonorrhea, HIV), fecal/oral transmission (hepatitis A), or droplets (influenza, TB) travel through the air, such as tuberculosis or measles.
7 0
3 years ago
strong winds and heavy precipitation are common along ......... front a .warm b.high pressure C. occluded d...sattionary
gulaghasi [49]
B. stationary front it has high winds and leaves precipitation, warm front doesn't really have the strong winds.
7 0
3 years ago
Greg Developed and Ear infection. His doctor gave him an antibiotic. The antibiotic killed all the bacteria in his body. What ot
Sati [7]
Antibiotics can have side effects.
When children take antibiotics at the first sign of an ear infection, they are more likely to have vomiting, diarrhea, and allergic reactions because of the medicine. Also, antibiotics can kill “friendly” germs in the body and cause other problems like diarrhea.

Over-use of antibiotics is a problem.
Antibiotics can help drug-resistant bacteria grow. These bacteria are harder to kill. They can cause illnesses that are harder to cure and more costly to treat. This increases the risk of complications and side effects. The resistant bacteria can also infect other people.

Hope this helps
8 0
3 years ago
Other questions:
  • A registered nurse advises a nursing student to value learning for learning's sake. which concept of critical-thinking behavior
    8·1 answer
  • Match each of the four barriers of innate immunity with its mode of action.
    9·1 answer
  • Explain why sexual reproduction increases variation among offspring much more than asexual reproduction does.
    7·1 answer
  • An empty truck and a fully loaded truck are next to each other at a traffic light. When the light turns green, the lighter truck
    13·2 answers
  • Which of these are characteristics of reptiles? Check all that apply.
    13·1 answer
  • There are nearly 30 different disorders of sexual development. Who can have these disorders?There are nearly 30 different disord
    11·1 answer
  • AG CLASS
    14·1 answer
  • A scientist has 400 grams of a radioactive substance with a half-life of one year. The amount of the substance that the scientis
    12·2 answers
  • Hi could somebody help me
    11·2 answers
  • What name is given to the process in which pre-mrna is edited into mrna?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!