1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
3 years ago
11

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Biology
1 answer:
liubo4ka [24]3 years ago
8 0

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

You might be interested in
Qué relación tiene la amilasa con el proceso evolutivo de los seres vivos que la Poseen
Anastaziya [24]

Answer:

pues existen muchas

Explanation:

para ello es una enzima hidrolasa

que tiene la funcion de catalizar

la reaccion denhidròlisis

8 0
3 years ago
Which statements describe properties that are unique to metalloids?
Reil [10]
I'm sorry but that answer is not correct. Metalloids actually share properties of metals and nonmetals.
7 0
3 years ago
Read 2 more answers
How do you adjust the focus of the microscope when observing organisms at high magnifications?
-Dominant- [34]

Answer:

The microscope is an instrument used for the visualization of the cell and its other component. Different types of microscope are compound microscope, electron microscope and binocular microscope.

The adjustment of the slide is important to visualize the focused object. A proper source of light is required to focus the image. At high magnification, the fine focus control is used for the adjustment. At 100 X the oil is used to visualize the object.

3 0
3 years ago
Is the universe bigger than earth
Ket [755]
Yes. The universe is EVERYTHING space is made of. Earth is just one planet
5 0
3 years ago
Read 2 more answers
A client has undergone scratch testing but the causative allergen is yet to be identified. what would be the next step to confir
hammer [34]

Answer:

Begin intradermal testing

Explanation:

Begin Intradermal allergy testing is a skin testing tool that provides a strong reposne against any specific allergen.

The procedure involves injecting a small amount of the alleged allergens under the skin surface. The region is being checked for a reaction at the site after around 20 minutes.

As intradermal test are invasive, they will give quick response in comparison to scratch test which is unable to identify teh allergen.

Hence, the correct answer is Begin Intradermal testing.

8 0
3 years ago
Other questions:
  • In terms of environmental economics, the only factions that disagree with one another are environmentalists and economists.
    5·2 answers
  • Which component is released from the active site of an enzyme during a chemical reaction?
    14·2 answers
  • ASAPPPP DUE IN 3 MINUTES
    14·1 answer
  • A human pancreatic cell obtains O2 Fuel molecules such as glucose and building material such as amino acids and cholesterol from
    6·1 answer
  • What are three ways atp is regenerated during muscle activity?
    13·1 answer
  • why do some scientists theorize that global warming might not be the result of increases in atmospheric carbon dioxide
    14·1 answer
  • Please help I really need this for today
    13·1 answer
  • In his work with pneumonia-causing bacteria, Frederick Griffith found that a non-pathogenic strain had been transformed into a p
    5·2 answers
  • Carotenoids are red, orange, or yellow pigments found in many plants. We know that plants contain chlorophyll a and b. What is t
    6·1 answer
  • Which lung volumes can be added together to calculate the functional residual capacity?.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!