1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
3 years ago
11

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Biology
1 answer:
liubo4ka [24]3 years ago
8 0

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

You might be interested in
facial dimples and free earlobes are both considered dominant human traits. What is expected phenotypic ratio of the offspring o
Len [333]

Answer:

9:3:3:1

Explanation:

pretty sure it's 9:3:3:1, I might be wrong sorry

6 0
3 years ago
What are the similarities and differences between the low-light seedlings and the moderate-light seedlings?
Natalka [10]

The similarities between the low-light seedlings and moderate-light seedlings are the amount of chlorophyll until 12 hours and the differences suddenly increase after this period.

<h3>What is photosynthesis rate?</h3>

The photosynthesis rate is the amount of photosynthetic products (i.e., glucose) that generates by a plant in a given unit of time, which depends on the amount of chlorophyll.

In this case,  low-light seedlings and moderate-light seedlings produce amount of chlorophyll at a similar rate until 12 hours, while the maximized value for moderate-light seedlings and low-light seedlings is 48 hours.

In conclusion, the similarities between the low-light seedlings and moderate-light seedlings are the amount of chlorophyll until 12 hours and the differences suddenly increase after this period.

Learn more about the photosynthesis rate here:

brainly.com/question/303300

#SPJ1

7 0
2 years ago
The scientist is studying the processes for which cellular respiration provides
Sauron [17]

Answer:

Glucose molecules in the bloodstream are absorbed by a muscle cell

4 0
3 years ago
Explain why rabbits are more destructive in Australia than in the U.S.?
Dmitrij [34]
There are no natural predators of rabbits in Australia, so they are able to reproduce at an alarming rate unharmed. In the US however, there are foxes and other animals that prey on rabbits, which helps keep the rabbit population lower.
3 0
3 years ago
Why an observation cannot be an inference
Dahasolnce [82]

Answer:

An observation cannot be an inference, because an observation takes place before an inference can be determined.

Explanation:

4 0
3 years ago
Other questions:
  • In developed nations, which nutrients are most apt to be lacking in a child's diet?
    14·1 answer
  • What group is this in
    6·1 answer
  • According to the all-or-none law, ____.​
    8·1 answer
  • In human beings the statistical probability of getting either a male or female is 50:50. Give reason and explain with help of di
    7·1 answer
  • What problems would you expect to observe in an ecosystem without secondary consumers? Be sure to answer this question in paragr
    5·2 answers
  • Give an example of four different types of algae and give two uses we use them for
    13·1 answer
  • True or false: Active transport is required to more particles from an area of lower
    12·1 answer
  • Question 3
    13·2 answers
  • What is one thing the government. Businesses and or India can do to get people to improve/increase carbon sinks
    8·1 answer
  • 1. True or False - An organism may have the same common names that remain the same from area to area and language to language.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!