1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
3 years ago
11

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Biology
1 answer:
liubo4ka [24]3 years ago
8 0

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

You might be interested in
If an organism has a diploid chromosome number of 24, what would the haploid number be?
inysia [295]
12
But what I got taught was that in a haploid cell there was 23 but that may be in a specific thing.
4 0
3 years ago
When does the body make most of its nerve cells
Pepsi [2]

Answer:The target cells of neurons include other nerve cells in the brain, spinal cord, and autonomic ganglia, and the cells of muscles and glands throughout the body.

Explanation:please give braineest

6 0
2 years ago
Read 2 more answers
Describe how mutation and genetic recombination increase genetic variation
Gekata [30.6K]

Answer:

Genetic variation can be caused by mutation (which can create entirely new alleles in a population), random mating, random fertilization, and recombination between homologous chromosomes during meiosis (which reshuffles alleles within an organism's offspring).

Explanation:

Hope this helps.  

3 0
3 years ago
Why does CaCl2 need to be added to cells to make them 'competent'? Why does CaCl2 need to be added to cells to make them 'compet
V125BC [204]
DNA is a negatively-charged molecule. Also cell membranes are negatively charged. The problem would be how to push this charges together? I<span>f you put some CaCl2 into the mixture, the CaCl2 will "split" giving 2Cl- and Ca2+. This last ion will be attracted by the negatively charged DNA and will "cover" it, hiding its negative charge. Hope this answers the question.</span>
8 0
3 years ago
1. Animals that mostly eat other animals fit into the dietary category called __________.
mezya [45]

Answer:

butt

Explanation:

hahahahahaha

5 0
3 years ago
Other questions:
  • When the body receives stimuli, which structure typically processes the stimuli?
    8·2 answers
  • The most abundant mineral in lithogenous sediments is __________.
    8·1 answer
  • The plant roots being underground respire by using which mechanism?
    12·1 answer
  • Mitosis results in
    15·2 answers
  • What is the ratio of surface area to volume for a sphere with the following
    15·1 answer
  • The panda eating bamboo is an example of what life process
    5·2 answers
  • What element has the same atomic weight as iridium?
    8·2 answers
  • Which organisms are producers?
    6·1 answer
  • Complete the following sentence
    5·1 answer
  • What neurological factors cause increased risk to excessive drinking?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!