1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
3 years ago
11

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Biology
1 answer:
liubo4ka [24]3 years ago
8 0

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

You might be interested in
(Easy question)<br> What is an Adaptation?
OlgaM077 [116]

Answer:

The way something changes to fit its natural environment or surroundings to have a better chance at success for anything

Explanation:

8 0
3 years ago
Read 2 more answers
What question did Hardy and Weinberg want to answer?
Stels [109]
How does allele frequency and genotype frequencies changes between generations
in the end, they found out that the allele frequency and the genotype frequency will remain constant from generations if evolution is absent.

I Believe This Is The Answer :)
6 0
4 years ago
Read 2 more answers
Please help. I thought the answer is prokaryotic but its not and there are no answer choices.
Usimov [2.4K]

Answer:

it is a prokaryotic plant cell, bc of the cell wall.

Explanation:

5 0
3 years ago
How often is a baby Wolf born
VARVARA [1.3K]
2 times pro year and sometimes 3 times
3 0
4 years ago
Read 2 more answers
Predators can be...<br> A. omnivores.<br> B. producers.<br> C. autotrophs.
Ivanshal [37]

Answer:

Predators are animals that hunt and kill other animals for food. Both carnivores and omnivores can be predators. The other classification of carnivores and omnivores is scavengers, which means they feed off of animals that are already dead. Predators include lions, sharks and eagles.

3 0
3 years ago
Read 2 more answers
Other questions:
  • When a solution of cesium chloride (CsCl) is subjected to high-speed centrifugation, a stable density gradient is formed. Mesels
    11·1 answer
  • What is the element that every like thing contains
    5·1 answer
  • Hepatitis d virus is described as a defective virus because it cannot reproduce in a cell unless the cell is also infected with
    10·1 answer
  • Classify each group of fungi based on their reproductive structures and behavior.
    13·2 answers
  • Why would it be hard to find the ideal CO2 level if the light intensity were very low?
    5·1 answer
  • 1. What type of study has as its goal to find the differences and similarities among items?
    13·1 answer
  • Why can an exogenous protein, protein that is added by experimentalists that has the same amino acid sequence as endogenous prot
    12·1 answer
  • A structure located to the front of another structure is considered to be
    10·1 answer
  • Which of thr following features differentiates sporozoans from the other phyla of protozoans?
    11·1 answer
  • During one year eight turtles are born into q population
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!