1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
3 years ago
11

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Biology
1 answer:
liubo4ka [24]3 years ago
8 0

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

You might be interested in
When deprived of oxygen, yeast will perform glycolysis followed by fermentation. During glycolysis, the yeast take electrons fro
lora16 [44]

Answer:

NAD  is reduced  

Explanation:

Glycolysis is the first step in the breakdown of glucose in order to generate  energy for cellular metabolism. Glycolysis helps to convert glucose into pyruvate and hydrogen ion.

In redox reaction, oxidation is the removal of hydrogen and reduction is the addition of oxygen. In the process of glycolysis, the NAD is reduced  to form NADH  and H.

If NAD is not present,  glycolysis will not be able to continue. During  aerobic respiration, the NADH formed in  glycolysis will be oxidized to reform NAD+ for  use in glycolysis again.

6 0
3 years ago
What type of membrane protein has a
skelet666 [1.2K]

Answer: C

This membrane protein is a <u>receptor protein.</u> Polytopic membranes cross the membrane for the molecules a couple times. The answer is C.

Hope it helps!

5 0
3 years ago
How do immunizations work with viruses? They cure the person by killing the virus cells and preventing the symptoms.They show th
Elanso [62]

b. They show the body virus pieces to prepare it to fight that virus in the future.

8 0
4 years ago
You've been growing numerous plants in a greenhouse in dishes called flats. Different flats have different number of plant speci
KATRIN_1 [288]
I think the correct answer would be C. It would be restricting water and/or nutrients, instead of supplying ample quantities of both that would not change the results of the experiment. This is because you are still supplying the same amount of nutrients and other things needed by the plant so the ratio of the growth of the plants will still be the same.
6 0
3 years ago
Animal cell diagram and labeled
pshichka [43]

Answer:

hereeeee just search from online and then u get it

5 0
3 years ago
Other questions:
  • Food that has been through the digestive process is called
    11·1 answer
  • What is the input signal that causes insulin to be released from a beta cell?
    15·1 answer
  • Describe three functions of the cell membrane
    8·1 answer
  • Why are certain amnio acids called a essential amnio acid?
    9·2 answers
  • Who has a comicly large spoon for scooping hunks of poop in your mouth
    5·2 answers
  • Of earths total volume of fresh Walter what percentage is frozen
    14·1 answer
  • Many ancient societies had some form of science. However, modern science originated in an ancient
    5·1 answer
  • Soft chancres on the genitals are characteristic of the sexually transmitted disease known as _____.
    8·1 answer
  • Identify the stages of meiotic devision<br>​
    14·1 answer
  • The lungs of an animal, shown here, exchange gases with the environment to allow for oxygen to move in and carbon dioxide to mov
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!