1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
3 years ago
11

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Biology
1 answer:
liubo4ka [24]3 years ago
8 0

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

You might be interested in
Adrenergic synapses release the neurotransmitter in the
zubka84 [21]

Answer:  Sympathetic nervous system.

Explanation:

In the adrenergic synapse, the neurotransmitter is norepinephrine. Adrenergic synapses release the neurotransmitter in the Sympathetic nervous system. This system controls reactions related to Increase brain activity and alertness, Dilation of the pupils, Crystalline accommodation for distance vision, Increased Respiratory and Cardiac Frequency, Vasodilation in the muscles of the legs, Reduction of salivary secretion, gastric and intestinal.

7 0
3 years ago
Wind blows finer particles long distances from glacial environments, where they settle out a form
fenix001 [56]

Hey There,

Wind blows finer particles long distances from glacial environments, where they settle out to form <u>firn</u>. Firn is a type of snow which is located on the upper part of a glacier that has not turned into ice.

7 0
3 years ago
How can the Nimitz ship float
iragen [17]
Bc of the bottom of the ship. the hull, is designed to displace a large amount of water.
4 0
3 years ago
can someone please help me with this? I'm not asking for all the answers, I just need an explanation and a few ideas. Thanks.
inessss [21]

not only in the land but also in the ocean there is food web that is why we can find different spices of creature in the ocean alive

there are producer consumer and decomposer

u can present by giving example

u can give oration how the organisms are adapted in the water

5 0
3 years ago
Read 2 more answers
How did Mendel cross-pollinate flowers
alekssr [168]
He took swabs of one pea plant and put it on others to help them reproduce.
8 0
3 years ago
Read 2 more answers
Other questions:
  • The production of offspring is a characteristic of life that enables the continuation of a species.
    10·1 answer
  • Changes to the global climate could include___.
    8·1 answer
  • Which of these is NOT something that happens when the soil is<br> overused?
    10·1 answer
  • The _____ microscope uses multiple glass lenses to help distinguish details of thickness.
    14·2 answers
  • Which statement does NOT describe a scientific theory?
    15·1 answer
  • Natural selection can affect the diversity of organisms within a population. This can sometimes be seen through the distribution
    11·1 answer
  • Describe in detail the structure and function of a DNA molecule, including the phosphate group, sugar and base as well as bondin
    5·1 answer
  • What is the limitations of classifying organisms by appearance
    14·1 answer
  • Please heeeeeeeeeeeeelp
    11·1 answer
  • A condition in which the number of red cells or the amount of hemoglobin is below normal
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!