1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
3 years ago
11

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Biology
1 answer:
liubo4ka [24]3 years ago
8 0

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

You might be interested in
Based on the information above, which of the following is true about the process in which the genetic code stored in DNA is used
DanielleElmas [232]

Answer:

D.This process requires the interaction of several different cellular structures,

Explanation:

We don't have the information above. However, this process occurs in all cells, and it requires energy. Semi-conservative refers to the fact that, during DNA replication, each new molecule of DNA is made up of one strand of the original DNA molecule and one strand of a new molecule.

The synthesis of proteins from the information in an mRNA molecule does require several structures in the cell, including the nucleus, ribosomes, endoplasmic reticulum and Golgi apparatus.

4 0
3 years ago
What molecules can be use for long term energy storage
sleet_krkn [62]

Answer:

Lipids are molecules that can be used for long-term energy storage.

Explanation:

5 0
3 years ago
Which component of a urinalysis reflects the amount of waste products and solids in urine?
tigry1 [53]

The component of urinalysis that reflects the amount of waste products and solids in urine is called Specific Gravity

A urine test examines the various elements in urine.

The kidneys filter the blood to remove waste products, minerals, water, and other chemicals that are then excreted in the urine. There are countless distinct bodily wastes in urine.

Urine can be used in more than 100 different tests. The tests for color, clarity, odor and specific gravity are frequently performed as part of a routine urinalysis.

The amount of chemicals in the urine is measured using specific gravity. Additionally, it demonstrates how effectively the kidneys regulate the amount of water in urine.

The more solid stuff there is in the urine, the greater its specific gravity. When you consume a lot of liquids, your kidneys produce urine with low specific gravity and high water content. Your kidneys produce urine with high specific gravity and little water when you don't drink any fluids.

To learn more about urinalysis please click on the link brainly.com/question/8696585

#SPJ4

5 0
2 years ago
The gentic information contained in the cell resulting meiosis
vekshin1

Answer:

By the end of meiosis, the resulting reproductive cells, or gametes, each have 23 genetically unique chromosomes. ... Unlike in mitosis, the daughter cells produced during meiosis are genetically diverse.

Explanation:

6 0
3 years ago
The diagram shows a certain kind of cell with all of its major parts labeled.
murzikaleks [220]
The Answer is D because prokaryotic lack membrane bound organelles
7 0
4 years ago
Read 2 more answers
Other questions:
  • In fruit flies, long wings are dominant over short vestigial wings. Which punnet square would have 50% of the offspring have lon
    7·1 answer
  • Help!!!!!!!!!!!!!!!!!!!!!!!
    5·1 answer
  • Which is a
    13·1 answer
  • Poem about layers of the atmosphere
    13·1 answer
  • What molecule would be considered a covelant compound
    13·2 answers
  • Analyze: Was the increase in the average beak depth caused by an increase in
    5·1 answer
  • In a monohybrid cross of corn plants, purple seeds (P) are dominant to yellow (Y). Both parents in the original cross are homozy
    10·1 answer
  • How are both types of fermentation used in the food and beverage industry?
    8·2 answers
  • TRUE OR FALSE: CYANOBACTERIA IS A GROUP OF BACTERIA THAT USED TO BE CLASSIFIED AS ALGAE
    15·2 answers
  • In digestion why do some food molecules decrease by the same amount that others increase.
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!