1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
3 years ago
11

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Biology
1 answer:
liubo4ka [24]3 years ago
8 0

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

You might be interested in
A Ribosome's primary function is to:
Temka [501]

Answer:

A ribosome, formed from two subunits locking together, functions to: (1) Translate encoded information from the cell nucleus provided by messenger ribonucleic acid (mRNA), (2) Link together amino acids selected and collected from the cytoplasm by transfer ribonucleic acid (tRNA). hope that helps❤

6 0
3 years ago
Read 2 more answers
How can a scientist test a hypothesis if it is not possible to do a controlled experiment.
serious [3.7K]

Answer:

In an experiment, the researcher needs to have a control group with an experimental group where both groups are identical in every way except that the controlled group does not gets the experimental treatment.

Sometimes, it is not possible to do a test or the experiment utilizing a controlled trial (due to ethical reasons or no practical method available). All things considered, a researcher may test a theory by making predictions about outcomes or patterns that ought to be found in nature if the hypothesis is right.

3 0
3 years ago
New ocean crust is formed at?
umka2103 [35]
It is formed at Divergent boundaries, two tectonic plates diverge from one another. New oceanic crust is being formed by hot molten rock slowly cooling and solidifying. The crust is very thin.
4 0
3 years ago
Read 2 more answers
Find the surface area
OverLord2011 [107]

the surface area of a figure in square units is the number of unit square it takes to cover entire surface without the gas or overlapse if three dimensional figure has + sides the sides called faces the surface area is the total of the area of the faces

3 0
2 years ago
Help! I just woke up and started doing school and now i have to take a quiz =/.
olga_2 [115]
For the first question the answer is Linnaeus

For the second question the answer is D, Organisms can be classified based on similar traits

For the third one the answer is C, the black snakes will survive and reproduce passing their traits to their offspring...

For the last one it’s A, some insects in a population survive temperature changes and pass their traits on to their offspring

Hope I helped!!
8 0
3 years ago
Other questions:
  • Where does first pass metabolism occur? / what route of administration is used to avoid complete first pass metabolism?
    14·1 answer
  • Which of the following is NOT a source of genetic variation?
    8·1 answer
  • 1. Scientists believe that ancient ancestors of all animals were (1 point)
    6·1 answer
  • I WILL GIVE BRANLIEST FOR ANSWER
    12·1 answer
  • The process of _______ causes rocks to change composition when reacting with oxygen
    9·1 answer
  • The most forward part of the frontal lobe of the cerebral cortex, known as the ____, is involved with ____.
    5·1 answer
  • All living things are made of organic compounds which contain the element:
    10·2 answers
  • If a DNA code was T-G-G-A-C, what would be the RNA code that matched the DNA?
    9·1 answer
  • I am to lazy to write this so somebody answer these please
    7·1 answer
  • BLOCK:
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!