1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
2 years ago
11

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Biology
1 answer:
liubo4ka [24]2 years ago
8 0

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

You might be interested in
The outermost layer of Menings is _______.​
MaRussiya [10]

Dura mater...............

8 0
3 years ago
Read 2 more answers
Which is the best evidence to prove that irene was heterozygous for hemophilia
love history [14]

A. Alice carried the recessive allele


4 0
3 years ago
Easy points 1 suggest what the drug longmasterol might do to the body to affect reaction time 2describe the effect of longmaster
Semmy [17]

Answer:

4.Antagonistic muscles are muscles that have opposite effects to one another,As one relaxes, the other contracts.

5, This is to move bones in tandem to cause locomotion.As as one contracts, and the other relaxes, the bone is pulled and this shifts the position of the bone to cause locomotion.Note, a muscle cell usually pull in one direction.,

6. it lacks nucleus to have enough space for oxygen carrying molecules(haemoglobin)it has bi-concave shape to squeeze through tinny capillaries to reach tissues and have large surface area for oxygen carriage.They contain Oxygen carrying pigment Haemoglobin.

1.This is a stimulant that increases the rate of excitability by increasing the synaptic connection through increase in amount neurotransmitters, at synaptic junctions

2,This accelerate the rate of ageing.Leading to premature aging.it ,may affect the heart efficiency and the entire cardiovascular system at the long run.

3. After a period of time this may cause liver damage by blocking blood flows to the liver.It may also lead to inhibitory effect of detoxification activities of the liver.This leads to hepatic failure.

7. A state of matter can only be compressed at  the gaseous state.it can not be compressed at solid because the inter molecular forces are very strong and the molecules of solids are well compact. Molecules of liquids are not free neither, although their molecular force are weak, But the molecules can not be compressed, since they lack random motion.

8. This is due to the lattice arrangement of water molecules in ice, resulting in lesser density of ice compare to that of water. The lower density of ice makes ice to float when it freezes, however, it is the higher lattice arrangement in ice which makes it expand, compare to other liquids which makes it less dense and therefore floats.

10. This can be caused by the force that pull water through the mains to the pipes.it is measures in bars. Thus 1 bar is equal to the force per unit area lifting water to a height of 10 meters.

9. This is to generate a forward thrust, to overcome the aerodynamic drug.The propeller engine generate a thrust, which ensure a steady speed  large enough to overcome the drag

5 0
3 years ago
What is the importance of crossing-over?
nikklg [1K]

Answer:

b.It increases the likelihood that daughter cells contain different genetic material.

Explanation:

Morgan and Cattell for the first time used the term ‘crossing over’.  Crossing over takes place during prophase I of meiosis. During crossing over, chromosome segments of non-sister chromatids of homologous chromosomes get exchanged. As a result, the daughter cells acquire different genetic materials. Thus, it provides genetic variation by creating a new combination of genes or get recombination and produces hybrids.

3 0
3 years ago
PLEASE HELP ASAP IN A RUSH!!What is not true of mitosis? A. It is the division of the genetic material of a dividing eukaryotic
bonufazy [111]
I think the answer is D but it's been a while since I've done this.

5 0
3 years ago
Other questions:
  • For a species with four pairs of chromosomes, ________ gametic combinations are possible
    5·1 answer
  • Which is the first step to occur during the process of replication?
    13·1 answer
  • Why do complimentary nucleotides across the double stranded DNA bond together using hydrogen bonds rather than covalent bonds
    15·1 answer
  • Traits that are sex linked are carried on
    7·2 answers
  • Who takes care of the final layout of the product that meets the standards set by LUX designers?
    14·1 answer
  • Which natural event can occur either over a few weeks or over a few million years?
    12·1 answer
  • Is the composition of air consistent
    7·2 answers
  • Why can the giant baleen whales grow so large? Give two reasons to support your answer..
    13·1 answer
  • About how many days pass between a new moon and a 3rd quarter moon?
    11·1 answer
  • What is the site of Photosynthesis?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!