Question

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Answer 1

The mRNA generated below was produced in the  nucleus of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

• The synthesis of the mRNA s called transcription

• The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.

• It requires nucleotide triphosphates as substrates
• catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054