1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
2 years ago
11

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Biology
1 answer:
liubo4ka [24]2 years ago
8 0

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

You might be interested in
Chromatin fiber is group of nucleosomes right?
Morgarella [4.7K]

Answer:

yes

Explanation:

Nucleosomes fold up to form a 30-nanometer chromatin fiber, which forms loops averaging 300 nanometers in length. The 300 nm fibers are compressed and folded to produce a 250 nm-wide fiber, which is tightly coiled into the chromatid of a chromosome.

6 0
2 years ago
Read 2 more answers
Rewrite Newton's 1st law in your own words and under 5 words
mash [69]
<span>Newton first law is called inertia, or the force an object has to resist unbalanced forces that are placed upon it. The more mass an object has, the more inertia an object has. The less mass an object has, the less inertia an object has.</span>
3 0
3 years ago
Hormones what they do their target organ what organ produces
kaheart [24]
Hormones are chemical substances that help to regulate processes in the body. Hormones are secreted by glands and travel to their target organs in the bloodstream. Hormones can be used to control human fertility.
7 0
3 years ago
Which organelle is involved in the storing of water in plant cells?
Y_Kistochka [10]

Answer:

Your answer would be Vacuoles

Explanation:

7 0
3 years ago
Read 2 more answers
Which type of cell DOES have membrane-bound organelles?<br> A. eukaryotic<br><br> B. prokaryotic
Vlad1618 [11]
A. Eukaryotic because Ik Im right
7 0
3 years ago
Read 2 more answers
Other questions:
  • What material (food/air) frog trachea transport? for a frog
    12·1 answer
  • Which country was the first to participate in swimming as a competitive sport?
    5·2 answers
  • Im lighter than the feather but the strongest man can not hold me for long
    7·2 answers
  • Theodor W. Engelmann illuminated a filament of algae with light that passed through a prism, thus exposing different segments of
    7·1 answer
  • NADPH is created by which photosystem of the light reactions of photosynthesis?
    13·1 answer
  • Need Answer ASAP. Why do disruptive selection pressures tend to favor rapid evolutionary changes?
    6·1 answer
  • Natural disasters can also play a huge role in changing selection pressures for a species. How could a natural disaster cause a
    15·1 answer
  • Describe the interactions between transcription factors and promoter sites that lead to the initiation of transcription. Predict
    13·1 answer
  • Skin color, fur color, and height are examples of which inheritance pattern?
    10·1 answer
  • 2. Why do Earth's tectonic plates move?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!