1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
2 years ago
11

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Biology
1 answer:
liubo4ka [24]2 years ago
8 0

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

You might be interested in
One side of ur face is identical to the other side you are
Nataliya [291]

Answer:

yeah otherwise it would have being abnormal

4 0
3 years ago
Read 2 more answers
Mitosis would be used to reproduce which cells?
sertanlavr [38]

Answer:

c

Explanation:

3 0
2 years ago
Read 2 more answers
If an organism feeds on a plant containing 3500 joules of energy,how much energy will the consumer be able to obtain? A.0.35 Jou
pishuonlain [190]
D- 350 J

Explanation:
The consumer only gets about 10% of their foods energy
6 0
2 years ago
Question 1 of 10
Aneli [31]

Answer:Option A

Explanation: The snail breaths in the O2 which will then exhale CO2, therefore the plant will take that and process the CO2 back into O2.

3 0
3 years ago
Table salt, glass, fertilizers, and gemstones are all made from ____
vladimir1956 [14]
They are made from igneous, metamorphic and sedimentary rock.
6 0
3 years ago
Read 2 more answers
Other questions:
  • Which properties of minerals can we not accurately rely on because it can change even amongst the same mineral?
    8·1 answer
  • _____________, which is abbreviated ____, is a diagnostic technique that beams ionizing x-rays at multiple angles around a speci
    10·1 answer
  • What trophic level is most affected by biological magnification?
    13·1 answer
  • Give three reasons why flowers are important in our day life​
    15·2 answers
  • Which condition can cause a population crash?
    11·1 answer
  • The lymphatic system is composed of all of the following except
    12·1 answer
  • Which of the following best explains how insulin injections affect signal transduction in an individual with type 1 diabetes
    15·1 answer
  • ¿que son los ligamentos suspensorios cristalino?
    8·1 answer
  • James fills a graduated cylinder with 50 mL of water. He then drops a 60g key into the graduated cylinder. The water level insid
    11·1 answer
  • Differentiate between kidneys and lungs​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!