1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
2 years ago
11

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Biology
1 answer:
liubo4ka [24]2 years ago
8 0

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

You might be interested in
Where does almost all the energy that drives life on the earth originate
zlopas [31]
The sun with out it nothing would exist it would just be a cold solid rock floating through space.
4 0
3 years ago
What is predator-prey relationship and why is it important?
sineoko [7]

Answer:

hope it's help you ok have a good day

4 0
3 years ago
The circle graph below shows the percentage of water which are used for various activities in the United States which statement
zloy xaker [14]

Answer:

The answer is A. industrial use of water is greater than the amount used to cool power plants.

Explanation:

it just is

3 0
3 years ago
Since we can’t drink ocean water due to its salt content, why is polluting the oceans so much a concern for people?
oksano4ka [1.4K]
Th polluting oh the ocean is a big concern for people because the animals the some people depend on for food are being killed.
3 0
3 years ago
Read 2 more answers
What are bacteria a necessary part of the nitrogen cycle?
34kurt
<span> Because when bacteria convert ammonia into nitrates and nitrites, producers need them to make proteins, and then consumers eat the producers and reuse the nitrogen to make their own proteins.

Hope this helps!

-Payshence xoxo</span>
4 0
3 years ago
Other questions:
  • 1. How is the potential energy of an object related to its position? (hint: if an object is higher up will it have more or less
    14·2 answers
  • An invasive species has the same niche as the squirrel in the community
    6·2 answers
  • Explain the most common machine in the human body
    8·1 answer
  • Which organism was most likely to live st the same time as brachiopods
    5·1 answer
  • Explain how fluctuations in abiotic cycles can influence populations
    15·2 answers
  • A(n) ______ is one present in the common ancestor and all members of the group. primitive character homologous structure analogo
    6·1 answer
  • Why is bacteria good for copying large amounts of DNA?
    11·2 answers
  • Select all the correct answers.
    13·1 answer
  • Please help<br> question is in photo
    7·1 answer
  • Which among the following elements belong to period 3 in the periodic table? ​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!