1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
2 years ago
11

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Biology
1 answer:
liubo4ka [24]2 years ago
8 0

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

You might be interested in
List 4 piece's of evidence that support the theory plate tectonics
Akimi4 [234]
Sea Floor Magnetism, Fossil Evidence, <span>Distribution of volcanoes and earthquakes on the globe </span>and Continental drift. 
5 0
3 years ago
Animals which have the ability to determine the survivability of other
kramer

Answer:

scientist has brought together all the research on the subject and found that, from bees to birds to wolves, many animals have an ability to process and represent numbers arguably a form of counting.

Explanation: What's more, the new study suggests that this mathematical prowess helps animals stay alive in a brutal world. Such a finding extends our knowledge of animal cognition, a field that has grown exponentially in recent years.

8 0
2 years ago
1. Why does the Howler monkey howl?
Alla [95]

Answer:

d

Explanation:

4 0
2 years ago
All systems should aim to achieve 99.999-percent uptime. true false
Crank
This statement <span>''All systems should aim to achieve 99.999-percent up time''</span> is false.


In reality, all systems should aim to achieve an up time of 99.99%

The different between 0.99 and 0.9999 might not seem a lot but if we actually calculate the percentage points it represents and the amount with which we need to improve efficiently, it almost becomes impossible to reach 99.9999% up time.

6 0
2 years ago
Which type of molecule includes an example with a long-chain carbon backbone
Lesechka [4]
The molecule that includes an example with a long chain carbon backbone is lipids.
5 0
3 years ago
Other questions:
  • Which of the following are tenets of the cell theory
    15·1 answer
  • Can someone help me
    11·2 answers
  • A wave with a frequency of 0.5 Hz and a speed of 10 m/s has a wavelength of a. 50 m. c. 20 m. b. 0.5 m. d. 0.2 m. Please select
    13·1 answer
  • In a polar covalent bond, the distribution of common electrons are _____. not shared evenly due to a greater positive charge fro
    6·2 answers
  • a cell has 10% salt solution and 90% water solution,while the beaker has 30% salt solution and 70% water solution. what happens
    5·1 answer
  • 1. Insects Have three pairs of legs or are the ______ arthropods.
    9·1 answer
  • Kevin and his grandparents live in Michigan north of the equator they we're planning vacation to Argentina South America south o
    14·1 answer
  • Does this graph show an endothermic of exothermic reaction?
    12·2 answers
  • Need help please
    15·1 answer
  • A friend of your shares that he would like to work in forensics because he really loves crime show on TV and wants to solve myst
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!