1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
2 years ago
11

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Biology
1 answer:
liubo4ka [24]2 years ago
8 0

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

You might be interested in
What is not a unique property of water
timofeeve [1]

Answer:

Water molecules stick together by cohesion

Explanation:

This sticking together of like substances is called cohesion. Depending on how attracted molecules of the same substance are to one another, the substance will be more or less cohesive. Hydrogen bonds cause water to be exceptionally attracted to each other. Therefore, water is very cohesive.

<em>I hope this helps out some~ <3</em>

<em>-Dream</em>

7 0
3 years ago
What is the term for an atom that is electrically charged as a result of gaining or losing electrons?
Dmitriy789 [7]

Answer:

An ion

Explanation:

An ion is a charged atom

Na+

Cl-

K+

SO2-

4 0
3 years ago
Read 2 more answers
Why is it important to scientists for a hypothesis to be testable? How would the experiment differ if it were not?
Vsevolod [243]

Answer:

A Scientific Hypothesis Must Be Testable

For a hypothesis to be testable means that it is possible to make observations that agree or disagree with it. If a hypothesis cannot be tested by making observations, it is not scientific.19-Feb-2021

Explanation:

3 0
3 years ago
Why is variations beneficial to the species but not necessary to individuals ​
Nimfa-mama [501]
Variations are beneficial for the survival of the species. Populations of organisms fill well-defined places, or niches, in the ecosystem, using their ability to reproduce.However, if some variations were to be present in a few individuals in these populations, there would be some chance for them to survive.
8 0
3 years ago
Read 2 more answers
A few years after a devastating forest fire, pioneer trees become established. after another 50 years, those trees are replaced
Keith_Richards [23]
Abiotic factors composed of water, light, temperature and air etc. due to fire's this primary succession was completely destroyed. Their remaining organic bodies were decomposed in soil texture.

In order to establish secondary succession there is need of water and light, because water help in translocation of food and nutrients in plants while light is important for photosynthesis.

Photosynthesis need three major components. these are H₂O, CO₂ and light, all these components are abiotic part of ecosystem. However, when secondary succession occurs, then light play a key role in changing the composition of plant community. The best example is the difference in height of plants of different community.
4 0
3 years ago
Other questions:
  • The notion that living organisms with advantages that give them greater reproductive success (in some local environment) will su
    13·1 answer
  • What type of bird is this
    11·1 answer
  • Describe the role of enzymes in transcription and translation
    12·1 answer
  • How does cytoskeleton relate to something in every day life
    8·2 answers
  • QUICK BRAINLEST PLEASE! I is a easy question... I just don't know it.
    14·1 answer
  • Where did dogs come from?
    11·1 answer
  • Hat is an ionic bond?
    11·1 answer
  • The species of plasmodium that cause the disease malaria are found in
    10·2 answers
  • What do you predict would happen to the cytoplasm of the onion cell as salt is added?
    10·1 answer
  • How fast can you answer how fast can i mark u brainliest???
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!