1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lubov Fominskaja [6]
3 years ago
5

Decomposers break down the remains of organic material and return it to the soil. Which populations in a forest ecosystem does t

his process most directly benefit?
A. owls and hawks

B. frogs and toads

C. trees and ferns

D. rabbits and raccoons
Biology
1 answer:
Pie3 years ago
5 0
The correct answer is c
You might be interested in
Producers, like this plant, take in oxygen and release carbon dioxide during______,just like animals and other living things
Mamont248 [21]

Answer:

d cellular respiration

3 0
3 years ago
Read 2 more answers
5.
Elis [28]

Answer:

The environment has the greatest effect on the expression of genes when which of the following occurs? relies on meiosis, a process that promotes recombination of genes, for the production of gametes. The ability for people to roll their tongue is dominant to people who cannot.

Explanation:

3 0
3 years ago
1.scientist solve problem in an organised way called ________
Hatshy [7]

Answer:

1. Scientific method

2. pseudopods

3. In 1909, Ernest Rutherford’s

4. innovation

5. nerve cell

5 0
3 years ago
Read the scenario below and answer the question that follows. There are two rival pet stores located across the street from each
Luden [163]

Answer:

D. It is not a superordinate goal because it did not require both pet store owners to accomplish.

Explanation:

In this case, both pet stores are benefited and therefore it corresponds to a superordinate goal.

3 0
3 years ago
The water cycle involves the constant movement of water from the ground to the atmosphere. Which of these
natita [175]

Answer:

Evaporation, Condensation, Precipitation and Collection

Explanation:

I just referred to water cycle on the internet.

5 0
3 years ago
Other questions:
  • When information concerning HIV/AIDS, mental health, and substance abuse is released to a third party, a _____ prohibits sharing
    6·1 answer
  • Which of the following uses a particularly dense suite of tight junctions to prevent microbes from entering the underlying tissu
    5·1 answer
  • Photosynthesis occurs
    10·1 answer
  • Which statements could be categorized in the "Asexual" section of the Venn diagram? Check all that apply
    5·1 answer
  • Explain why osmosis is important in plant and animal​
    11·2 answers
  • The sun’s energy is most useful to humans after it is converted to _____.
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • PLEASE ANSWER QUICKLY! WILL GIVE BRAINLIEST
    7·2 answers
  • What genetic trait(s) do varieties of GMO corn contain that non-GMO
    9·1 answer
  • Hiiiii , i am alona , how are u all
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!