1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
N76 [4]
3 years ago
11

Why are polysaccharides more difficult to digest than monosaccharides ?

Biology
1 answer:
zhenek [66]3 years ago
5 0
Polysaccharides are more difficult to digest then monosaccharides because they are much larger molecules. 


You might be interested in
Some people see wind energy as a clean alternative to fossil fuels. Others believe that utilizing this renewable energy resource
Y_Kistochka [10]

Answer:

Renewable energy resource as an obstacles for the growth of migratory salmon populations: It is now believed that the reduce access to spawning grounds and nursery areas, leading to a decrease in migratory fish populations is due to the dam structures of large storage-type schemes, which can create great obstacles for the movement of migratory fish species.

Explanation:

  • Storage-type schemes ( big dams) can significantly change the downstream flow regime,and may also alter water temperature and quality, and even make it inhabitable for fish to live.
  • As the storage of water can be linked with high evaporative losses, which in turn results in high life cycle water footprints compared to other sources of electricity.

<u>Run-of-river (ROR) schemes are HEP schemes: </u>

They operate without water storage, using the flow within a river channel.They are ecologically friendly and do not disturb the natural mechanism for the migrating salmons.

Working Principle:

They are normally used to regulate water levels, which allows a proportion or part of flow to be diverted down a secondary channel to a turbine before it is returned to the main channel further downstream.

There are some modern turbine types used in ROR HEP(hydroelectric power) schemes, which are also designed to allow fish to pass through the system unharmed if the fish do pass through the intake screens.

8 0
3 years ago
Put the following events in the correct order:
Wewaii [24]

Answer:

Explanation:

c. Transcription of one DNA strand results in mRNA, which is a complementary copy of the information in the DNA.

a. The mRNA leaves the nucleus and goes to a ribosome open choices for ranking.

b. The building blocks of proteins, are carried to the ribosome by tRNAsAmino acids.

The process of deoxyribonucleic acod starts with replication to transcription and translation.

Replication involves the formation of a complementary base from a old or template DNA Strand this then serve as a template for transcription.

transcription involves the coping of information on the DNA to an intermediate mRNA ( messanger ribonucleic acid) in the nucleus which then move from the nucleus to ribosome in the cytoplasm where translation occurs.

Translation is the conversion of the information on the mRNA to an amino acid with the help of enzyme transferse ribonucleic acid(tRNA).

Hence the arrangement is from C ---- A-----B.

3 0
3 years ago
1
DaniilM [7]

Answer:The anesthesia has blocked the Inter-neurons from carrying signals to the brain.

5 0
3 years ago
Which sequence lists the correct order of events in the area represented in the diagram?
maria [59]

You didn’t add the diagram

8 0
3 years ago
True or false: The sequence of nucleotides in DNA codes for proteins and is key to cell function and life.
kondaur [170]
The answer is true for both 13 and 14. im not positive but i have just recently gone over this.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Mendels pea plants how do either purple or white flowers . This means that the plants A. Can self-pollinate B.have two recessive
    14·1 answer
  • The nurse has administered promethazine intravenously to a client in active labor. the drug has had the desired effect when the
    8·1 answer
  • Where in the Cell is DNA found?<br> Mitochondria<br> Ribosome<br> Nucleus<br> Cytoplasm
    14·2 answers
  • Name the different divisions of animals according to their habitats​
    14·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What significant negative effect on the environment cause by obtaining water from a well?
    8·1 answer
  • Which macromolecule includes steroids
    15·2 answers
  • Austin is in a study related to Mary Ainsworth's theory of mother-infant attachment. He is securely attached. Therefore, he show
    5·1 answer
  • Height,hair color,eye color,and intelligence are traits passed on by__
    10·1 answer
  • can you do short answers because it will not allowed you to write that much on the paper. Plz and ty!!!.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!