1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jek_recluse [69]
3 years ago
15

When a person inhales, oxygen fills tiny air sacs in the person's lungs. Next, the oxygen moves from these air sacs into small b

lood vessels that line the lungs, and then it moves into the bloodstream so that it can be transported around the body.
Oxygen moves by random molecular motion from the air sacs of the lungs to the blood vessels because the concentration of oxygen in the air sacs is higher than the concentration of oxygen in the blood vessels.

This movement of oxygen molecules from an area of higher concentration to an area of lower concentration is known as _______.
Biology
1 answer:
Zinaida [17]3 years ago
5 0
This process is called diffusion
You might be interested in
The genes for miniature wings (m) and garnet eyes (g) are approximately 8 map units apart on chromosome 1 in Drosophila. Phenoty
Anestetic [448]

The following phenotypic classes reflect offspring that were generated as a result of a crossover event

  • wild type
  • miniature wings
  • garnet eyes

Explanation:

When the miniature wings and garnet eyes links up with the 8 map unit that are present between them. After that the presence of two recombinant classes must complement together and make 8% of total i.e. they contribute 4% each. together the parental classes make up to 92% by contributing 46% one.

This can be understood through a phenotypic ratio calculation, which can be expected from it.

wild type: 4% x 800 = 32

miniature wings: 46% x 800 = 368

garnet eyes: 46% x 800 = 368

miniature wings, garnet eyes: 4% x 800 = 368

5 0
3 years ago
Why is it important for the cell membrane to allow materials to enter and leave the cell
umka21 [38]
<span>Cell membrane needs to allow and exit the materials that enter the cell because the cell needs nutrients and these nutrients are converted into molecules that aid in many cellular activities like repair, divide and form structures and biomolecules.
Also to excrete wastes and other harmful materials for the cell.
This continues because the cell wants to attain homeostasis.

Homeostasis is the state where the internal and external part of the body maintains and establishes balance and equilibrium. This is achieved through cellular processes in the body, the integumentary system regulates the body temperature, the hypothalamus –hunger and thirst of the individual and other interrelated organ systems that make the body healthy and in the state of equilibrium. Now, when diseases or disorders appear they disrupt the organ systems in the body thus, causing imbalance state –high fever, inability to focus and etc.<span>
</span></span>
5 0
3 years ago
Astronomers studying the planet of Rhombus have detected sedimentary rock on its surface. One astronomer wonders if material in
Gwar [14]
Answer:
igneous rock CAN become sedimentary rock through a process called ROCK CYCLE.
Explanation:
Rocks can be defined as solid structures of minerals that are formed naturally over a period of time. They are grouped into three main types which includes the following:
- igneous rock
- sedimentary rocks and
- metamorphic rocks.
Rocks are capable of transforming from one type to another through a process known as rock cycle. There are two forces that brings about this process which includes:
- The internal force : this is the Earth’s internal heat engine, which moves material around in the core and the mantle and leads to slow but significant changes within the crust.
- The external force: this is the the hydrological cycle, which is the movement of water, ice, and air at the surface, and is powered by the sun.
Molten magma cools to form either extrusive igneous rock or intrusive igneous rock. With time they undergo weathering, eroded, transported, and then deposited as sediments which are being compressed and cemented into SEDIMENTARY ROCKS. Again through the above mentioned forces, different kinds of rocks are either uplifted, to be re-eroded, or buried deeper within the crust where they are heated up, squeezed, and changed into METAMORPHIC ROCK.
Therefore the material in this sedimentary rock found in Rhombus planet used to be in igneous rock deep in Rhombus's interior due to continuous rock cycling on the planet. I hope this helps
8 0
3 years ago
Read 2 more answers
A heterozygous gray (two genes are involved) cat is crossed with a cat that is heterozygous for these two genes. What is the pro
romanna [79]

Answer:50% chance, and the genotype would be heterozygous

Explanation:

G=gray r=black

      G     r

G   GG   Gr

r     Gr    rr

3 0
3 years ago
Given the history of corn in the western hemisphere, what would be the best strategy for survival of the Zea species?
Scilla [17]

The answer is C) Increase genetic variation and breed plants to contain the wild variety.

4 0
3 years ago
Other questions:
  • What biological macromolecule is made up of monomers like the one shown below? Answer Carbohydrate Fat Nucleic acid Protein
    14·2 answers
  • Why are ecological pyramids shaped as pyramids?
    14·2 answers
  • Determine if the data are qualitative or quantitative.
    6·2 answers
  • Gregor Mendel used pea plants to study Question 36 options: a. flowering. b. gamete formation. c. the inheritance of traits. d.
    12·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Identify the organelles labeled
    13·1 answer
  • What percentage of global water is fresh water? 1% 10% 20% 25%
    7·2 answers
  • Which feature of the sun is caused due to an irruption of high-energy radiation
    15·2 answers
  • Which of the following is rich in organic nutrients? 
    11·1 answer
  • How can raw water treated in city when supply system for class 5 in the short answer​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!