1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AysviL [449]
3 years ago
9

Today i am very happy​

Biology
2 answers:
tester [92]3 years ago
6 0

Answer:

o really .why?

Explanation:

god bless u.

always remain happy and healthy.

keep smiling

Alex787 [66]3 years ago
3 0

Answer:

and why are u so happy today ????

Explanation:

You might be interested in
What treatment is being compared to the control in the experiment? what treatment is being compared to the control in the experi
stepan [7]

The correct answer is: the treated glioblastoma cells were cultured in the presence of an inhibitor from umbilical cord stem cells, but the control cells were cultured without the inhibitor.

It has been shown that treatment with injected umbilical cord stem cells has strong therapeutic effects on glioma models. Those cells produce anti-tumour substances, with inhibitory effects.

Control group does not include the treatment in order to observe the treatment.


7 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Which of the following is an example of a falsiable hypothesis that could lead to scientific knowledge A.aliens have crashed on
pav-90 [236]

Answer:

D. No aliens have crashed on earth

8 0
3 years ago
Read 2 more answers
What type of selection affects traits that influence an individual's chances to find a mating partner or be chosen as a mating p
melamori03 [73]

Answer:

Sexual selection

Explanation:

It is sexual selection because it is a type of natural selection in which an organism or organisms acquire traits which help the individual to be choose as a mating partner or to have preference for a mating partner or for competition among one sex organisms in which a traits succeed.

Sexual selection can be intrasexual or or intersexual. Intrasexual is is competition between one sex of the same organism and intersexual is between sexes of different organism.

3 0
3 years ago
Which of these is an effect of overcrowding in an environment? A. species create new habitats to survive B. predator-prey relati
slega [8]
I think it is D but I might be wrong !!! Hope I help !!
6 0
3 years ago
Other questions:
  • The metal lithium is a psychoactive drug used to treat symptoms of
    13·1 answer
  • This illustration shows the process of making a protein molecule. The site of protein synthesis in a cell is the ____
    6·2 answers
  • What Are The Three main parts of small intestine ? and explain jejunum iliem are adapted for absorption of nutrients.?​
    8·1 answer
  • Terms in order from smallest to largest: species, biosphere, cell
    9·2 answers
  • Name the organs in the digestive system where there are stratified epithelia.
    6·1 answer
  • Which part of a DNA molecule carries the genetic instructions that are unique for each individual: the sugar-phosphate backbone
    12·1 answer
  • The DNA of a fly and the DNA of a gorilla are made up of subunits that are
    8·2 answers
  • How many of the animal phyla include single celled animals?
    14·2 answers
  • As a long bone develops, the point where osteoblasts first replace calcified cartilage with spongy bone becomes the ________, fr
    10·1 answer
  • Write a complete paragraph caption for this graph. Start with a topic sentence that describes the whole graph. In the body of th
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!