1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Verizon [17]
4 years ago
10

Which best explains why metal cooking utensils often have plastic coating on their handles?

Biology
2 answers:
Llana [10]4 years ago
5 0
Because heat travles through metal
BlackZzzverrR [31]4 years ago
4 0
Metal is a conductor of heat while plastic is more resistant of heat
You might be interested in
Which of the following is likely abiotic limiting factor of fish in a pond ecosystem? pollution
Korvikt [17]

Pollution :) Since Abiotic means non living.

Bacteria: Living

Food (worms or smaller fish): Living

Predators: Living

Pollution (dirt, trash, or other stuff): Non Living

3 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
When cells break down food molecules energy is
never [62]
When cells break down food molecules energy is released
3 0
3 years ago
Who wrote the origin of continents and oceans
sergij07 [2.7K]

Answer:Alfred Wegener

Explanation:He searched the scientific literature for geological and paleontological.

6 0
3 years ago
What describes the relationship between transcription and translation
andrew11 [14]

Answer:

Translation is the process of translating the sequence of a messenger RNA molecule to a sequence of amino acids during protein synthesis. So, the relationship between the two processes is that they are both involved in protein synthesis and that transcription is first, then translation is second.

Explanation:

7 0
3 years ago
Other questions:
  • Does the polarity of the multimeter leads matter when taking resistance measurements
    9·1 answer
  • Why don't red blood cells pop in the bloodstream?
    12·2 answers
  • How does your body make use of sugars such as glucose from carbohydrates?
    9·2 answers
  • How does your body get energy?
    11·1 answer
  • This cell is in which stage of mitosis?
    11·1 answer
  • If you wanted to alter the structure of a bottom-up community, your best bet would be to A) remove the top predators. B) remove
    10·1 answer
  • Cell Structure and Function
    14·1 answer
  • Match the following with their proper definitions.
    5·1 answer
  • In which organs would chemicals digesttionof the chicken takes place​
    14·1 answer
  • Biological change over time accounts for the diversity of species. This diversity
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!