1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cricket20 [7]
3 years ago
13

Briefly describe why all burners must be turned off before any developing chambers are prepared

Biology
1 answer:
suter [353]3 years ago
3 0
<span>The burners must be turned off because, in the case of liquid chromatography, the eluant solvents being used are flammable. Leaving the burners lit could cause the eluant to catch on fire, putting the scientist at risk.</span>
You might be interested in
In which location in the human body will the catalase reaction be predicted to be slowest? F.) Brain G.) Heart H.) Liver J.) Sto
natali 33 [55]

Answer:

brain

Explanation:

I am sorry if this wrong

8 0
3 years ago
What are molecular organizers of cell? How do they work?
kupik [55]

Explanation:

protect cells and organelles from the surrounding environment

6 0
3 years ago
Read 2 more answers
Two differences between hormones and the nervous system
leva [86]

Answer:

Hormones can be proteins, lipids or cholesterol-based molecules. Neurotransmitters are protein. The main difference between hormones and neurotransmitters is that Hormones are produced in the endocrine glands and released into the bloodstream where they find their movement targets at a distance from their origin. In contrast, Neurotransmitters are released into the synaptic space by a terminal of an excited presynaptic nerve cell and transmit a nerve signal to the neighboring postsynaptic nerve cell.

Explanation:

7 0
3 years ago
Read 2 more answers
HELP!!!!!!!!!
tino4ka555 [31]

Correct answer: C). Cells are the basic building blocks of life but do not constitute life itself

Cell theory in a biology is a scientific theory, which is universally accepted and it states that all living organism are made up of one or more cells, cell is the building block of living thing, it also states that all cell arise from ore existing cells.

The cell theory is collection of ideas and conclusion, which were given after many years of continuous research and experiment of many scientist, which tells about the cell and how it operates.



5 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Darwin is considered the "father of modern evolutionary biology." four of his contributions to the field of evolutionary biology
    13·1 answer
  • Why does carbon move easily through the atmosphere?
    6·1 answer
  • Brian has a medical condition called cone dystrophy, which is a disorder of the cone cells in the eye. What symptoms would you e
    15·2 answers
  • Which form of selective breeding crosses parents with the same or similar sets of alleles? a. fertilization b. inbreeding c. hyb
    10·1 answer
  • _______are bodies of water flowing water moving in one direction. ocean, pond and river
    8·2 answers
  • The temporalis muscle originates on the __________ and inserts on the __________. a. zygomatic arch; temporal fossa b. temporal
    13·2 answers
  • Which of the following statements correctly describes the effect a nonsense mutation would have on a gene?a) It changes an amino
    14·1 answer
  • Head lice, small insects, are found on two elementary school students. As these two students
    8·2 answers
  • What does the name “Anthropocene” imply?
    14·2 answers
  • Changing environmental conditions, such as temperature or pH, can affect enzyme shape. How would this alter the enzyme's functio
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!